Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25729
Trapped Gene
Igf2bp2 (ENSMUSG00000033581)
Vector Insertion
Chr 16: 22161524 - 22162858
Public Clones not available
Private Clones OST168874 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000333342 (Chr16:22162859..22163107 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACTCAAGTCCGGCTACGC Chr16:22162915..22162934 60.04 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000333342 (Chr16:22162859..22163107 -)
Downstram Exon
ENSMUSE00000702656 (Chr16:22161319..22161523 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACTCAAGTCCGGCTACGC Chr16:22162915..22162934 60.04 60 TTTCCCATGCAATTCCACTT Chr16:22161335..22161354 60.31 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000333342 Chr16:22162859..22163107 CTACTCAAGTCCGGCTACGC Chr16:22162915..22162934 60.04 60

*** Putative Vector Insertion (Chr 16: 22161524 - 22162858) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000310923 Chr16:22161319..22161379 TTTCCCATGCAATTCCACTT Chr16:22161335..22161354 60.31 40
downstream ENSMUSE00000702656 Chr16:22161319..22161523 TTTCCCATGCAATTCCACTT Chr16:22161335..22161354 60.31 40
downstream ENSMUSE00000702654 Chr16:22121270..22121322 CATACCTTGGCCACTGTGAA Chr16:22121273..22121292 59.57 50
downstream ENSMUSE00000310911 Chr16:22089135..22089183 CCGAATCTGGATTCTTCTGC Chr16:22089140..22089159 59.77 50
downstream ENSMUSE00000560970 Chr16:22087601..22087652 CTTGCTCCACGTTCTCCACT Chr16:22087579..22087598 60.44 55
downstream ENSMUSE00000310892 Chr16:22083997..22084060 GTTGACAACGGCAGTTTCTG Chr16:22084007..22084026 59.34 50
downstream ENSMUSE00000310885 Chr16:22081807..22082058 CTTCATCGGGGATGTAGGAA Chr16:22081966..22081985 59.89 50
downstream ENSMUSE00000310877 Chr16:22080140..22080274 GGGGTAGCATGGATTGTGAC Chr16:22080187..22080206 60.2 55
downstream ENSMUSE00000310871 Chr16:22079557..22079679 GTCTTCCAACGAAGCCATTG Chr16:22079605..22079624 60.64 50
downstream ENSMUSE00000310865 Chr16:22078689..22078824 TGATGGTTCTCTCGGGGTTA Chr16:22078762..22078781 60.45 50
downstream ENSMUSE00000310855 Chr16:22076090..22076218 GCACAGACAGTCCAGTCGAA Chr16:22076127..22076146 60.03 55
downstream ENSMUSE00000644781 Chr16:22070380..22070448 TGGAGAAGTATCCGGAGTGG Chr16:22070405..22070424 60.06 55
downstream ENSMUSE00000310847 Chr16:22068216..22068332 TGGGTTGGGATGAAGAGACT Chr16:22068270..22068289 59.51 50
downstream ENSMUSE00000644775 Chr16:22065166..22065240 TAAACTGGGCTTCAGGAGGA Chr16:22065146..22065165 59.81 50
downstream ENSMUSE00000644773 Chr16:22063655..22063786 GGCCTCCAGCTTCACTTCTT Chr16:22063690..22063709 60.9 55
downstream ENSMUSE00000644771 Chr16:22061933..22062046 AATGCCCGATAATTCTGACG Chr16:22061925..22061944 59.92 45
downstream ENSMUSE00000702655 Chr16:22059533..22060958 GTGGTTCGCATTTGTTCCTT Chr16:22059835..22059854 59.98 45
downstream ENSMUSE00000644770 Chr16:22059149..22060958 CTCACGGCACGTACCCTATT Chr16:22059228..22059247 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACATC Chr16:22162787..22162808 62.97 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000033581