Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25737
Trapped Gene
Uba3 (ENSMUSG00000030061)
Vector Insertion
Chr 6: 97155342 - 97155526
Public Clones not available
Private Clones OST168478 (lexicon) OST96542 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695343 (Chr6:97155527..97155554 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695343 (Chr6:97155527..97155554 -)
Downstram Exon
ENSMUSE00000244916 (Chr6:97155300..97155341 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGCCAGCAGCTCCTCTATT Chr6:97155282..97155301 59.74 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695343 Chr6:97155527..97155554 No primer for this exon

*** Putative Vector Insertion (Chr 6: 97155342 - 97155526) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000244916 Chr6:97155300..97155341 CAGCCAGCAGCTCCTCTATT Chr6:97155282..97155301 59.74 55
downstream ENSMUSE00000244911 Chr6:97153468..97153588 GACCTTCCCAGTCTCCAGTG Chr6:97153520..97153539 59.68 60
downstream ENSMUSE00000244909 Chr6:97151911..97151991 ACATCCTAAGCCACCAGCTC Chr6:97151907..97151926 59.31 55
downstream ENSMUSE00000244906 Chr6:97149233..97149315 No primer for this exon
downstream ENSMUSE00000194806 Chr6:97146831..97146911 TTGGGTCTTCCGACATCTTT Chr6:97146866..97146885 59.53 45
downstream ENSMUSE00000194801 Chr6:97142735..97142778 No primer for this exon
downstream ENSMUSE00000194788 Chr6:97141520..97141584 GTCCAGGCCACATACAATGA Chr6:97141534..97141553 59.37 50
downstream ENSMUSE00000194797 Chr6:97141087..97141242 GCACTCAATACAAGCGGTCA Chr6:97141089..97141108 59.87 50
downstream ENSMUSE00000194803 Chr6:97139748..97139850 AGGCTGCTCTTTAGGCCATT Chr6:97139733..97139752 60.36 50
downstream ENSMUSE00000194791 Chr6:97139523..97139636 No primer for this exon
downstream ENSMUSE00000194785 Chr6:97136657..97136710 No primer for this exon
downstream ENSMUSE00000194799 Chr6:97136231..97136267 TTGAAAACCTCAGTGGCACA Chr6:97136221..97136240 60.28 45
downstream ENSMUSE00000194793 Chr6:97136063..97136144 CAGCCCATCTACATCATTGAA Chr6:97136071..97136091 58.59 42.86
downstream ENSMUSE00000194787 Chr6:97135644..97135744 TTGGCTACATGCTGGACAGT Chr6:97135699..97135718 59.32 50
downstream ENSMUSE00000194786 Chr6:97135477..97135540 GCTGTGATAGCCGGAGACTT Chr6:97135492..97135511 59.46 55
downstream ENSMUSE00000194795 Chr6:97135335..97135389 GGCCTGGTTCGTTCTTCAAT Chr6:97135336..97135355 61.38 50
downstream ENSMUSE00000695311 Chr6:97133813..97134859 TTCTTGGATGTTCCCCTCTG Chr6:97134646..97134665 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGAGAGTAATCGCCTTGC Chr6:97155463..97155483 59.03 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCGAGGAGCCGTAAGTATC Chr6:97155516..97155536 61.11 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030061