Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25761
Trapped Gene
BX890623.7-202 (ENSMUSG00000078893)
Vector Insertion
Chr 2: 175550374 - 175550436
Public Clones not available
Private Clones OST167318 (lexicon) OST66143 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678837 (Chr2:175550375..175551476 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTGTTTCCGAACATTGCTG Chr2:175551138..175551157 59.71 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678837 (Chr2:175550375..175551476 +)
Downstram Exon
ENSMUSE00000678842 (Chr2:175550375..175550435 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTGTTTCCGAACATTGCTG Chr2:175551138..175551157 59.71 40 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678845 Chr2:175541264..175541407 TGTGATGTGTTCTGCGTGAC Chr2:175541337..175541356 59.27 50
upstream ENSMUSE00000678838 Chr2:175541286..175541407 TGTGATGTGTTCTGCGTGAC Chr2:175541337..175541356 59.27 50
upstream ENSMUSE00000678844 Chr2:175544862..175544916 GCTGGATGCTGTGAATTTAGC Chr2:175544869..175544889 59.87 47.62
upstream ENSMUSE00000678840 Chr2:175544914..175544916 No primer for this exon
upstream ENSMUSE00000678843 Chr2:175550042..175550168 CTCAGGATGAGTGGGCTTTG Chr2:175550079..175550098 60.79 55

*** Putative Vector Insertion (Chr 2: 175550374 - 175550436) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678837 Chr2:175550375..175551476 CAGCAATGTTCGGAAACAAA Chr2:175551160..175551179 59.71 40
downstream ENSMUSE00000678842 Chr2:175550375..175550435 No primer for this exon
downstream ENSMUSE00000714091 Chr2:175551591..175553148 AGTCAGAGGGTTGCTCTGGA Chr2:175551631..175551650 59.99 55
downstream ENSMUSE00000717988 Chr2:175551591..175553148 AGTCAGAGGGTTGCTCTGGA Chr2:175551631..175551650 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:175550425..175550445 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000078893