Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25770
Trapped Gene
Tjap1 (ENSMUSG00000012296)
Vector Insertion
Chr 17: 46396433 - 46396885
Public Clones not available
Private Clones OST166855 (lexicon) OST136401 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136627 (Chr17:46396886..46396969 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136627 (Chr17:46396886..46396969 -)
Downstram Exon
ENSMUSE00000136623 (Chr17:46394826..46396432 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398694 Chr17:46419909..46419948 No primer for this exon
upstream ENSMUSE00000222842 Chr17:46419295..46419388 No primer for this exon
upstream ENSMUSE00000136622 Chr17:46401832..46401927 No primer for this exon
upstream ENSMUSE00000136626 Chr17:46400638..46400762 No primer for this exon
upstream ENSMUSE00000136629 Chr17:46399351..46399379 No primer for this exon
upstream ENSMUSE00000136624 Chr17:46398368..46398529 No primer for this exon
upstream ENSMUSE00000136628 Chr17:46398085..46398151 No primer for this exon
upstream ENSMUSE00000136625 Chr17:46397044..46397151 No primer for this exon
upstream ENSMUSE00000136627 Chr17:46396886..46396969 No primer for this exon

*** Putative Vector Insertion (Chr 17: 46396433 - 46396885) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136623 Chr17:46394826..46396432 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr17:46396815..46396835 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCTTCAGGATTGTGTCTGG Chr17:46396835..46396855 61.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000012296