Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25774
Trapped Gene
1500032L24Rik (ENSMUSG00000022452)
Vector Insertion
Chr 15: 82178471 - 82179272
Public Clones not available
Private Clones OST166671 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000127099 (Chr15:82178330..82178470 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTTGGTCTTCTCCGAGTG Chr15:82178334..82178353 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000127099 (Chr15:82178330..82178470 +)
Downstram Exon
ENSMUSE00000347077 (Chr15:82179273..82179492 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTTGGTCTTCTCCGAGTG Chr15:82178334..82178353 59.84 55 GGGCTCTTGTCACAAACCAT Chr15:82179395..82179414 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406151 Chr15:82176485..82176699 TCGAGGTCAGTCATCGTCAC Chr15:82176646..82176665 59.83 55
upstream ENSMUSE00000127099 Chr15:82178330..82178470 CCTTTGGTCTTCTCCGAGTG Chr15:82178334..82178353 59.84 55

*** Putative Vector Insertion (Chr 15: 82178471 - 82179272) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000347077 Chr15:82179273..82179492 GGGCTCTTGTCACAAACCAT Chr15:82179395..82179414 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGCGGATGATCTTAATCG Chr15:82178508..82178528 60.56 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATCTCGTGACTGGGAAAA Chr15:82178516..82178536 59.22 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022452