Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25786
Trapped Gene
Map2k5 (ENSMUSG00000058444)
Vector Insertion
Chr 9: 63205868 - 63219543
Public Clones not available
Private Clones OST166448 (lexicon)
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219104 (Chr9:63219544..63219592 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219104 (Chr9:63219544..63219592 -)
Downstram Exon
ENSMUSE00000219102 (Chr9:63205800..63205867 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGGACAGCATTGCCTTCATC Chr9:63205780..63205799 60.23 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000488693 Chr9:63224930..63225709 TTATCGCCTGCCTTCTGTCT Chr9:63225154..63225173 59.98 50
upstream ENSMUSE00000219104 Chr9:63219544..63219592 No primer for this exon

*** Putative Vector Insertion (Chr 9: 63205868 - 63219543) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219102 Chr9:63205800..63205867 AGGACAGCATTGCCTTCATC Chr9:63205780..63205799 60.23 50
downstream ENSMUSE00000219118 Chr9:63191194..63191263 GAAATATCTGCAGCGGCTCT Chr9:63191178..63191197 59.58 50
downstream ENSMUSE00000697519 Chr9:63188206..63188240 No primer for this exon
downstream ENSMUSE00000219106 Chr9:63186888..63186928 AGGCCATGTATGTTCCGTTC Chr9:63186870..63186889 59.82 50
downstream ENSMUSE00000219116 Chr9:63185892..63185959 ATTGCTTGGAAGCGAATCTG Chr9:63185872..63185891 60.35 45
downstream ENSMUSE00000219115 Chr9:63177715..63177763 CCGTTGGCCAGTATCTTTCT Chr9:63177697..63177716 59.19 50
downstream ENSMUSE00000219119 Chr9:63170010..63170074 GTAGACTGTGCCTCCGTTGC Chr9:63169990..63170009 60.87 60
downstream ENSMUSE00000697522 Chr9:63166603..63166618 No primer for this exon
downstream ENSMUSE00000419490 Chr9:63150928..63150967 TTTCCCACTTGGGACATGAT Chr9:63150921..63150940 60.17 45
downstream ENSMUSE00000419487 Chr9:63141503..63141571 CAGCTCAGACATGATCTGCTTC Chr9:63141496..63141517 60.16 50
downstream ENSMUSE00000419484 Chr9:63141331..63141412 AAAAATGCCCCGTAAAATCC Chr9:63141350..63141369 60.02 40
downstream ENSMUSE00000326547 Chr9:63134206..63134267 AAGGACGTGCTCTGGAATTTT Chr9:63134202..63134222 60.12 42.86
downstream ENSMUSE00000219122 Chr9:63128826..63128874 No primer for this exon
downstream ENSMUSE00000475873 Chr9:63110921..63110994 ACCTGTCCGCCTGTGTTTAC Chr9:63110930..63110949 60.03 55
downstream ENSMUSE00000219123 Chr9:63109951..63110001 TGCCATGTAAGCATTTGTTCC Chr9:63109929..63109949 60.88 42.86
downstream ENSMUSE00000219098 Chr9:63104784..63104855 TTCCTAAGCTCCACACGTCA Chr9:63104776..63104795 59.44 50
downstream ENSMUSE00000503592 Chr9:63083096..63083125 GGATATGGAAACCTCCCAAGA Chr9:63083078..63083098 60.14 47.62
downstream ENSMUSE00000326412 Chr9:63065146..63065172 No primer for this exon
downstream ENSMUSE00000326384 Chr9:63064800..63064832 ACAATGCACTGCAGAAGCTG Chr9:63064785..63064804 60.21 50
downstream ENSMUSE00000326359 Chr9:63045118..63045179 TACAAACGGCTCCGAGAACT Chr9:63045113..63045132 59.88 50
downstream ENSMUSE00000326330 Chr9:63042009..63042054 No primer for this exon
downstream ENSMUSE00000502404 Chr9:63011576..63011997 GGCCTGACCCTTTACAATGA Chr9:63011596..63011615 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr9:63216475..63216495 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGAAGCCATCCCACATCTT Chr9:63216501..63216521 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058444