Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2579
Trapped Gene
Leo1 (ENSMUSG00000042487)
Vector Insertion
Chr 9: 75308911 - 75314000
Public Clones XS0156 (sanger) (ggtc) CMHD-GT_434E7-3 (cmhd) CMHD-GT_513G11-3 (cmhd)
Private Clones OST461970 (lexicon) OST424347 (lexicon) OST422939 (lexicon) OST422836 (lexicon)
OST392686 (lexicon) OST371076 (lexicon) OST350750 (lexicon) OST350742 (lexicon)
OST324717 (lexicon) OST324715 (lexicon) OST324713 (lexicon) OST209448 (lexicon)
OST142995 (lexicon) OST59743 (lexicon) OST58568 (lexicon) OST58369 (lexicon)
OST58348 (lexicon) OST57707 (lexicon) OST57385 (lexicon) OST57384 (lexicon)
OST56891 (lexicon) OST56885 (lexicon) OST56583 (lexicon) OST55303 (lexicon)
OST54848 (lexicon) OST42926 (lexicon) OST42900 (lexicon) OST28503 (lexicon)
OST28319 (lexicon) OST27642 (lexicon) OST17449 (lexicon) OST17448 (lexicon)
OST16747 (lexicon) OST14246 (lexicon) OST14233 (lexicon) OST4027 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000275582 (Chr9:75308813..75308910 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGAGGGCTCCGAAGAAGAC Chr9:75308846..75308865 60.74 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000275582 (Chr9:75308813..75308910 +)
Downstram Exon
ENSMUSE00000363177 (Chr9:75314001..75314239 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGAGGGCTCCGAAGAAGAC Chr9:75308846..75308865 60.74 55 TTGTCATCGTCTTCCGCTTT Chr9:75314047..75314066 60.78 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000275902 Chr9:75289331..75289442 GGACATGGAGGACCTCTTCG Chr9:75289390..75289409 61.99 60
upstream ENSMUSE00000275864 Chr9:75293042..75293800 GGTGTCCGATGAGGAGAAAA Chr9:75293694..75293713 60.05 50
upstream ENSMUSE00000275844 Chr9:75294909..75295013 TTACGACTGAAGCGCAAGAA Chr9:75294944..75294963 59.75 45
upstream ENSMUSE00000275823 Chr9:75296109..75296203 TCGGAGGTGCAGATGACATA Chr9:75296133..75296152 60.22 50
upstream ENSMUSE00000275792 Chr9:75297164..75297309 AGCCCATACCTGAGACCAGA Chr9:75297201..75297220 59.68 55
upstream ENSMUSE00000275694 Chr9:75298295..75298379 GATGAGGAGATGCTGGATGAA Chr9:75298332..75298352 60.17 47.62
upstream ENSMUSE00000275665 Chr9:75302431..75302525 TCGTCAAGTGGTCAGATGGA Chr9:75302504..75302523 60.25 50
upstream ENSMUSE00000275637 Chr9:75303448..75303582 CCCTGCATTTAGGGAATGAA Chr9:75303453..75303472 59.89 45
upstream ENSMUSE00000275621 Chr9:75304865..75305000 CCAGCGCACAGAGATGATTA Chr9:75304979..75304998 59.97 50
upstream ENSMUSE00000275602 Chr9:75305882..75306068 CCATCAGGAGGGAGTCTCAG Chr9:75305907..75305926 59.78 60
upstream ENSMUSE00000275582 Chr9:75308813..75308910 ATGAGGGCTCCGAAGAAGAC Chr9:75308846..75308865 60.74 55

*** Putative Vector Insertion (Chr 9: 75308911 - 75314000) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000363177 Chr9:75314001..75314239 TTGTCATCGTCTTCCGCTTT Chr9:75314047..75314066 60.78 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGACTTGGTTAATCGCCTTG Chr9:75311952..75311973 60.49 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGTCGTGACTGGGAAAAC Chr9:75308957..75308977 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042487