Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25794
Trapped Gene
4632419K20Rik (ENSMUSG00000044465)
Vector Insertion
Chr 7: 112540182 - 112548397
Public Clones (sanger)
Private Clones OST166183 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000719956 (Chr7:112548398..112548522 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTGGTGCAAGTGAAAGAGA Chr7:112548430..112548449 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000719956 (Chr7:112548398..112548522 -)
Downstram Exon
ENSMUSE00000712218 (Chr7:112540091..112540181 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTGGTGCAAGTGAAAGAGA Chr7:112548430..112548449 60.03 50 GGCTCAGCTGTGTTTCCTCT Chr7:112540124..112540143 59.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436926 Chr7:112548398..112548525 CGTGGTGCAAGTGAAAGAGA Chr7:112548430..112548449 60.03 50
upstream ENSMUSE00000716976 Chr7:112548398..112548546 CGTGGTGCAAGTGAAAGAGA Chr7:112548430..112548449 60.03 50
upstream ENSMUSE00000719956 Chr7:112548398..112548522 CGTGGTGCAAGTGAAAGAGA Chr7:112548430..112548449 60.03 50

*** Putative Vector Insertion (Chr 7: 112540182 - 112548397) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000712218 Chr7:112540091..112540181 GGCTCAGCTGTGTTTCCTCT Chr7:112540124..112540143 59.6 55
downstream ENSMUSE00000436924 Chr7:112538535..112538866 CAATCTGCTTCATCCGGTCT Chr7:112538732..112538751 60.22 50
downstream ENSMUSE00000716956 Chr7:112538535..112538866 CAATCTGCTTCATCCGGTCT Chr7:112538732..112538751 60.22 50
downstream ENSMUSE00000503564 Chr7:112537768..112538406 CTGAAGGAACTGCTCGATCC Chr7:112538258..112538277 59.95 55
downstream ENSMUSE00000289443 Chr7:112537293..112537451 ATCTTTCGAGGCAGTGAGGA Chr7:112537380..112537399 59.95 50
downstream ENSMUSE00000289435 Chr7:112537070..112537156 CACCAGGAAACCATTGTGAA Chr7:112537075..112537094 59.39 45
downstream ENSMUSE00000289431 Chr7:112536698..112536865 TGGGTATCATGCCGATGTAA Chr7:112536722..112536741 59.77 45
downstream ENSMUSE00000289425 Chr7:112533857..112533936 TGAGGTTCAGAAGGGTCCTG Chr7:112533869..112533888 60.23 55
downstream ENSMUSE00000289417 Chr7:112533502..112533665 AAAGATCCACATCACGCACA Chr7:112533579..112533598 60.12 45
downstream ENSMUSE00000716496 Chr7:112533460..112533665 AAAGATCCACATCACGCACA Chr7:112533579..112533598 60.12 45
downstream ENSMUSE00000720002 Chr7:112532889..112533086 GAGCCACCTAGGCTCTGTTG Chr7:112532959..112532978 60.01 60
downstream ENSMUSE00000289404 Chr7:112532295..112533086 GAGCCACCTAGGCTCTGTTG Chr7:112532959..112532978 60.01 60
downstream ENSMUSE00000671188 Chr7:112532290..112533086 GAGCCACCTAGGCTCTGTTG Chr7:112532959..112532978 60.01 60
downstream ENSMUSE00000289393 Chr7:112529913..112530091 TGTTGGTGTTGAGCAGGAAA Chr7:112529926..112529945 60.28 45
downstream ENSMUSE00000436436 Chr7:112529594..112529756 TGGATAGCAGAGCAGGGAAG Chr7:112529662..112529681 60.49 55
downstream ENSMUSE00000506337 Chr7:112529594..112529732 TGGATAGCAGAGCAGGGAAG Chr7:112529662..112529681 60.49 55
downstream ENSMUSE00000715253 Chr7:112527126..112527643 AGTAATTCCCCCAAGGATGG Chr7:112527588..112527607 60.01 50
downstream ENSMUSE00000384683 Chr7:112527125..112527643 AGTAATTCCCCCAAGGATGG Chr7:112527588..112527607 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTGCAAGTGAAAGAGACG Chr7:112548426..112548446 60.03 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTGCAAGTGAAAGAGACG Chr7:112548426..112548446 60.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGTGAAGTTTAATCGCCTTGC Chr7:112545460..112545481 58.53 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGGAGAATGTGGAAATCGTG Chr7:112545468..112545488 60.32 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044465