Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25802
Trapped Gene
Skil (ENSMUSG00000027660)
Vector Insertion
Chr 3: 31012563 - 31015737
Public Clones not available
Private Clones OST165514 (lexicon)
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000171866 (Chr3:31012330..31012562 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGTGTCGCTCACATCTGC Chr3:31012367..31012386 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000171866 (Chr3:31012330..31012562 +)
Downstram Exon
ENSMUSE00000171863 (Chr3:31015738..31015961 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGTGTCGCTCACATCTGC Chr3:31012367..31012386 59.87 50 CATGATCTTCCCCTTGTCGT Chr3:31015886..31015905 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720909 Chr3:30993980..30994079 AGAGGCTGTGTGTAGCGATG Chr3:30993986..30994005 59.06 55
upstream ENSMUSE00000676089 Chr3:30993983..30994079 AGAGGCTGTGTGTAGCGATG Chr3:30993986..30994005 59.06 55
upstream ENSMUSE00000710533 Chr3:30994047..30994079 No primer for this exon
upstream ENSMUSE00000365462 Chr3:30995625..30997341 AGGGACGATACCTGCCTCTT Chr3:30995765..30995784 60.1 55
upstream ENSMUSE00000714563 Chr3:30995625..30996112 AGGGACGATACCTGCCTCTT Chr3:30995765..30995784 60.1 55
upstream ENSMUSE00000719433 Chr3:30995625..30997341 AGGGACGATACCTGCCTCTT Chr3:30995765..30995784 60.1 55
upstream ENSMUSE00000708585 Chr3:30995755..30997341 AGGGACGATACCTGCCTCTT Chr3:30995765..30995784 60.1 55
upstream ENSMUSE00000708811 Chr3:30996192..30996387 GATGATGGCAGTCCTCCTGT Chr3:30996319..30996338 60.08 55
upstream ENSMUSE00000715640 Chr3:30996628..30997341 CCCCTGACAAGAGAACTTGC Chr3:30997172..30997191 59.84 55
upstream ENSMUSE00000171865 Chr3:31010547..31010644 GATACACCATCGGGAATGGA Chr3:31010550..31010569 60.55 50
upstream ENSMUSE00000171866 Chr3:31012330..31012562 AATGTGTCGCTCACATCTGC Chr3:31012367..31012386 59.87 50
upstream ENSMUSE00000719075 Chr3:31012330..31012424 AATGTGTCGCTCACATCTGC Chr3:31012367..31012386 59.87 50

*** Putative Vector Insertion (Chr 3: 31012563 - 31015737) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171863 Chr3:31015738..31015961 CATGATCTTCCCCTTGTCGT Chr3:31015886..31015905 59.93 50
downstream ENSMUSE00000171864 Chr3:31016295..31016519 TCCTTCATCGCCTTTGAACT Chr3:31016335..31016354 59.81 45
downstream ENSMUSE00000335516 Chr3:31017377..31021499 AAGCCAACCTTACGAGAGCA Chr3:31019636..31019655 60.01 50
downstream ENSMUSE00000717340 Chr3:31017377..31017913 TCAAAGCAAGCGACAAACAC Chr3:31017599..31017618 60.03 45
downstream ENSMUSE00000718136 Chr3:31017377..31018202 TCAAAGCAAGCGACAAACAC Chr3:31017599..31017618 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCATTAATCGCCTTGCAG Chr3:31012608..31012628 62.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGCTAGTTAAGAAACCCATCG Chr3:31012593..31012616 59.8 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027660