Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2581
Trapped Gene
Gigyf2 (ENSMUSG00000048000)
Vector Insertion
Chr 1: 89333467 - 89336962
Public Clones XS0153 (sanger) XS0857 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000629281 (Chr1:89333344..89333466 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTGGGGTCAGCAGTCTAAC Chr1:89333360..89333379 60.71 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000629281 (Chr1:89333344..89333466 +)
Downstram Exon
ENSMUSE00000403228 (Chr1:89336963..89337187 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTGGGGTCAGCAGTCTAAC Chr1:89333360..89333379 60.71 60 GGCTCTGTTTGATTGCTGGT Chr1:89337178..89337197 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000510582 Chr1:89223617..89223667 GAGGCTGAGGATTGACTTGG Chr1:89223618..89223637 59.8 55
upstream ENSMUSE00000453040 Chr1:89230845..89230909 TGCTGAAACCTCTTGCTGTG Chr1:89230868..89230887 60.17 50
upstream ENSMUSE00000453004 Chr1:89250979..89251061 AGAATGGCAGCAGAAACACA Chr1:89251018..89251037 59.44 45
upstream ENSMUSE00000453001 Chr1:89260679..89260808 GGAGTATCACGTCCCCTCCT Chr1:89260702..89260721 60.34 60
upstream ENSMUSE00000452989 Chr1:89261759..89261854 TTGCCACCATTGGCTCTAGT Chr1:89261813..89261832 60.66 50
upstream ENSMUSE00000452983 Chr1:89270572..89270686 GGGCTCCTAGAGGTCGAAGT Chr1:89270651..89270670 59.84 60
upstream ENSMUSE00000452975 Chr1:89275547..89275658 GTGGCAGGGAAATGCATAGA Chr1:89275619..89275638 61 50
upstream ENSMUSE00000452970 Chr1:89276543..89276583 GACAGGCGCTTTGAAAAACC Chr1:89276547..89276566 62.02 50
upstream ENSMUSE00000452964 Chr1:89300242..89300421 GCGGTTAGCTGGATCAAGAA Chr1:89300369..89300388 60.35 50
upstream ENSMUSE00000452951 Chr1:89303559..89303776 ATGGGCACGTTTGACTCTTC Chr1:89303735..89303754 60.12 50
upstream ENSMUSE00000629285 Chr1:89303577..89303776 ATGGGCACGTTTGACTCTTC Chr1:89303735..89303754 60.12 50
upstream ENSMUSE00000452946 Chr1:89303868..89304030 TGACAGCAGCCATAACGAAG Chr1:89303948..89303967 60.01 50
upstream ENSMUSE00000452937 Chr1:89304110..89304298 CCAGGTACCCCTTCAGATCA Chr1:89304154..89304173 59.92 55
upstream ENSMUSE00000452928 Chr1:89307237..89307433 TGTCGCCTCCTGTTCCTACT Chr1:89307306..89307325 59.87 55
upstream ENSMUSE00000365871 Chr1:89308283..89308442 GCAAGAGCACCGAGCTAAAG Chr1:89308351..89308370 60.29 55
upstream ENSMUSE00000326310 Chr1:89313393..89313559 TGCTGGTGAAGAGAGCATGT Chr1:89313453..89313472 59.58 50
upstream ENSMUSE00000326303 Chr1:89315663..89315754 CAGATGCAGCACCTCCAGTA Chr1:89315717..89315736 60.01 55
upstream ENSMUSE00000326296 Chr1:89316860..89316967 AGGTTTTGGCTCAACAGCAG Chr1:89316874..89316893 60.43 50
upstream ENSMUSE00000452876 Chr1:89318066..89318166 GGCTCTATCTGGGAGCTTCA Chr1:89318124..89318143 59.53 55
upstream ENSMUSE00000452870 Chr1:89319756..89319856 GCAGCTAGAGAAGGCCAAAG Chr1:89319829..89319848 59.36 55
upstream ENSMUSE00000709702 Chr1:89321640..89321801 AAGAGGAGGAGCGAAAGAGG Chr1:89321683..89321702 60.09 55
upstream ENSMUSE00000720151 Chr1:89321640..89321801 AAGAGGAGGAGCGAAAGAGG Chr1:89321683..89321702 60.09 55
upstream ENSMUSE00000452857 Chr1:89325145..89325303 GGAAGCAGGAAGAACTGCTG Chr1:89325275..89325294 60.13 55
upstream ENSMUSE00000629283 Chr1:89325145..89325303 GGAAGCAGGAAGAACTGCTG Chr1:89325275..89325294 60.13 55
upstream ENSMUSE00000394316 Chr1:89330255..89330491 AGCAACAGCTTGCACAAATG Chr1:89330469..89330488 60.06 45
upstream ENSMUSE00000629282 Chr1:89330255..89330491 AGCAACAGCTTGCACAAATG Chr1:89330469..89330488 60.06 45
upstream ENSMUSE00000390720 Chr1:89333344..89333466 CGTGGGGTCAGCAGTCTAAC Chr1:89333360..89333379 60.71 60
upstream ENSMUSE00000629281 Chr1:89333344..89333466 CGTGGGGTCAGCAGTCTAAC Chr1:89333360..89333379 60.71 60

*** Putative Vector Insertion (Chr 1: 89333467 - 89336962) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000403228 Chr1:89336963..89337187 GGCTCTGTTTGATTGCTGGT Chr1:89337178..89337197 60.26 50
downstream ENSMUSE00000629280 Chr1:89336963..89337187 GGCTCTGTTTGATTGCTGGT Chr1:89337178..89337197 60.26 50
downstream ENSMUSE00000357149 Chr1:89337292..89337497 GCTGGTATGCAGGTTGGAAT Chr1:89337315..89337334 59.96 50
downstream ENSMUSE00000629279 Chr1:89337292..89337497 GCTGGTATGCAGGTTGGAAT Chr1:89337315..89337334 59.96 50
downstream ENSMUSE00000157365 Chr1:89338586..89338740 TCTGCCGGTTAGACACACCT Chr1:89338617..89338636 60.71 55
downstream ENSMUSE00000629278 Chr1:89338586..89338740 TCTGCCGGTTAGACACACCT Chr1:89338617..89338636 60.71 55
downstream ENSMUSE00000373135 Chr1:89340220..89340401 ACGCTGCTGGTTGACTTTCT Chr1:89340374..89340393 60.06 50
downstream ENSMUSE00000629277 Chr1:89340220..89340401 ACGCTGCTGGTTGACTTTCT Chr1:89340374..89340393 60.06 50
downstream ENSMUSE00000157369 Chr1:89342887..89343034 GCTCGAACCATCTTCTGCTT Chr1:89343020..89343039 59.58 50
downstream ENSMUSE00000629276 Chr1:89342887..89343034 GCTCGAACCATCTTCTGCTT Chr1:89343020..89343039 59.58 50
downstream ENSMUSE00000381432 Chr1:89345653..89347347 GGGCTGGTCCACTAGGTACA Chr1:89345935..89345954 59.99 60
downstream ENSMUSE00000629275 Chr1:89345653..89347347 GGGCTGGTCCACTAGGTACA Chr1:89345935..89345954 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCAGCTTCGTGAAGAGGTA Chr1:89333451..89333471 60.54 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCAGCTTCGTGAAGAGGTA Chr1:89333451..89333471 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048000