Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25827
Trapped Gene
Ppp1ca (ENSMUSG00000040385)
Vector Insertion
Chr 19: 4194907 - 4194981
Public Clones not available
Private Clones OST160490 (lexicon)
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000245799 (Chr19:4194772..4194906 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCAAGAGACAGTTGGTGA Chr19:4194798..4194817 60.44 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000245799 (Chr19:4194772..4194906 +)
Downstram Exon
ENSMUSE00000394395 (Chr19:4194982..4195419 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCAAGAGACAGTTGGTGA Chr19:4194798..4194817 60.44 50 CACAATCTGGTCTGCCATTG Chr19:4195340..4195359 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000245916 Chr19:4192178..4192271 GACAGCGAGAAGCTCAACCT Chr19:4192223..4192242 59.75 55
upstream ENSMUSE00000697240 Chr19:4192434..4192485 No primer for this exon
upstream ENSMUSE00000245885 Chr19:4192745..4192876 AAGAACGTGCAGCTGACAGA Chr19:4192765..4192784 59.78 50
upstream ENSMUSE00000461425 Chr19:4193022..4193252 TTATGTAGATCGGGGCAAGC Chr19:4193110..4193129 60.06 50
upstream ENSMUSE00000245838 Chr19:4193767..4193871 GGAAGACGTTCACTGACTGCT Chr19:4193794..4193814 59.51 52.38
upstream ENSMUSE00000245819 Chr19:4194467..4194690 GAATGACCGTGGTGTCTCCT Chr19:4194597..4194616 59.97 55
upstream ENSMUSE00000245799 Chr19:4194772..4194906 TGCCAAGAGACAGTTGGTGA Chr19:4194798..4194817 60.44 50

*** Putative Vector Insertion (Chr 19: 4194907 - 4194981) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000394395 Chr19:4194982..4195419 CACAATCTGGTCTGCCATTG Chr19:4195340..4195359 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000040385