Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25831
Trapped Gene
Zfp652 (ENSMUSG00000075595)
Vector Insertion
Chr 11: 95574048 - 95610313
Public Clones IST12999B5 (tigm) IST11010E2 (tigm) IST14539H5 (tigm)
Private Clones OST160117 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674202 (Chr11:95573987..95574047 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674202 (Chr11:95573987..95574047 +)
Downstram Exon
ENSMUSE00000674201 (Chr11:95610314..95611461 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCTCTGCACTTTTCCTACGG Chr11:95611219..95611238 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674202 Chr11:95573987..95574047 No primer for this exon

*** Putative Vector Insertion (Chr 11: 95574048 - 95610313) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674201 Chr11:95610314..95611461 GCTCTGCACTTTTCCTACGG Chr11:95611219..95611238 60.01 55
downstream ENSMUSE00000268212 Chr11:95610381..95611461 GCTCTGCACTTTTCCTACGG Chr11:95611219..95611238 60.01 55
downstream ENSMUSE00000674206 Chr11:95614189..95614336 No primer for this exon
downstream ENSMUSE00000674205 Chr11:95614676..95614791 GGAGTGCACCTTGAGTGACA Chr11:95614758..95614777 59.87 55
downstream ENSMUSE00000674204 Chr11:95615225..95615369 CACTGGCACATGAACTGCTT Chr11:95615313..95615332 59.9 50
downstream ENSMUSE00000674200 Chr11:95624853..95633667 CTCCGCAGTGGAGTTCTTTC Chr11:95629170..95629189 59.99 55
downstream ENSMUSE00000674203 Chr11:95624853..95626025 CACCAAAAGCTGAACCGAAT Chr11:95625787..95625806 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCATAGCTAATCGCCTTGC Chr11:95592091..95592111 61.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATTTGACAGCGTGACTGG Chr11:95592088..95592108 59.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075595