Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25832
Trapped Gene
Itgav (ENSMUSG00000027087)
Vector Insertion
Chr 2: 83588102 - 83595962
Public Clones not available
Private Clones OST159950 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000165940 (Chr2:83588010..83588101 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGGTTTGGAGCCTCTGTG Chr2:83588058..83588077 60.3 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000165940 (Chr2:83588010..83588101 +)
Downstram Exon
ENSMUSE00000165939 (Chr2:83595963..83596077 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGGTTTGGAGCCTCTGTG Chr2:83588058..83588077 60.3 55 TTGACCTGCATGGAGCATAC Chr2:83596080..83596099 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000565988 Chr2:83564672..83565076 CTGAAGTCTTTCGGCTCTGC Chr2:83564852..83564871 60.28 55
upstream ENSMUSE00000165942 Chr2:83576667..83576797 GGAGGGCAAGTTCTCAAATG Chr2:83576728..83576747 59.67 50
upstream ENSMUSE00000165940 Chr2:83588010..83588101 AGTGGTTTGGAGCCTCTGTG Chr2:83588058..83588077 60.3 55

*** Putative Vector Insertion (Chr 2: 83588102 - 83595962) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000165939 Chr2:83595963..83596077 TTGACCTGCATGGAGCATAC Chr2:83596080..83596099 59.68 50
downstream ENSMUSE00000165979 Chr2:83602025..83602086 GCTGAATCCTCCTTGACAAAA Chr2:83602073..83602093 59.3 42.86
downstream ENSMUSE00000165991 Chr2:83603809..83603854 ACCAGGACCACCGAGAAGTA Chr2:83603841..83603860 59.57 55
downstream ENSMUSE00000165934 Chr2:83605925..83606050 ACTTGGTCCGAAATGAGCTG Chr2:83605949..83605968 60.26 50
downstream ENSMUSE00000165962 Chr2:83606784..83606828 CCGTCACCATTGAAGTCTCC Chr2:83606823..83606842 60.51 55
downstream ENSMUSE00000165974 Chr2:83608452..83608495 TCCTTGCTGCTCTTGGAACT Chr2:83608487..83608506 60.13 50
downstream ENSMUSE00000165973 Chr2:83608849..83608905 No primer for this exon
downstream ENSMUSE00000165968 Chr2:83610210..83610262 No primer for this exon
downstream ENSMUSE00000165972 Chr2:83611292..83611494 CCAATGGAGCTATGGCACTT Chr2:83611470..83611489 60.1 50
downstream ENSMUSE00000165988 Chr2:83616525..83616716 GATTTGAGATGGCACCGAAT Chr2:83616628..83616647 59.9 45
downstream ENSMUSE00000238581 Chr2:83619171..83619216 AGCTCGATCCACACCAAAAG Chr2:83619208..83619227 60.26 50
downstream ENSMUSE00000409037 Chr2:83622096..83622203 TACAGTGACAACGGGTCTGG Chr2:83622120..83622139 59.59 55
downstream ENSMUSE00000165967 Chr2:83623962..83624020 TGCCTTTAAGCAGAATCTGACA Chr2:83623990..83624011 60.02 40.91
downstream ENSMUSE00000165937 Chr2:83625490..83625644 CGAAGATAGGCGACCAGTTC Chr2:83625646..83625665 59.84 55
downstream ENSMUSE00000165985 Chr2:83629074..83629211 TCTGGTCCAACCGATACTCC Chr2:83629143..83629162 59.93 55
downstream ENSMUSE00000165963 Chr2:83631352..83631419 No primer for this exon
downstream ENSMUSE00000238563 Chr2:83632050..83632197 CGGTGGGATAGAAACGATGA Chr2:83632164..83632183 60.85 50
downstream ENSMUSE00000165935 Chr2:83632708..83632800 CTGCCGAGTTTGGTTTTCTG Chr2:83632761..83632780 60.8 50
downstream ENSMUSE00000165947 Chr2:83634391..83634470 TCCATCTCTGACTGCTGGTG Chr2:83634440..83634459 59.98 55
downstream ENSMUSE00000165950 Chr2:83635076..83635156 TATCTCCACAGCAGCCAAAA Chr2:83635154..83635173 59.42 45
downstream ENSMUSE00000165952 Chr2:83635596..83635701 CAATAGGCCCAACGTCTTCT Chr2:83635687..83635706 59.19 50
downstream ENSMUSE00000165932 Chr2:83636243..83636401 CCCGTCAATGTCGTAATGAA Chr2:83636356..83636375 59.4 45
downstream ENSMUSE00000165965 Chr2:83637508..83637609 GCCGCTGTGTCATTCTTTTC Chr2:83637536..83637555 60.79 50
downstream ENSMUSE00000165983 Chr2:83641927..83642040 GCCTCTATCCAGTCGACCAA Chr2:83641989..83642008 60.22 55
downstream ENSMUSE00000165956 Chr2:83642135..83642242 ATCGGCAGGTTCTTGTAAGG Chr2:83642220..83642239 59.19 50
downstream ENSMUSE00000165976 Chr2:83643037..83643159 GCGAGAACTGCCAAGATGAT Chr2:83643119..83643138 60.37 50
downstream ENSMUSE00000601026 Chr2:83643397..83643964 GAACTTGGAGCGGACAGAAG Chr2:83643536..83643555 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGTGAGGTCAAAGCAGGA Chr2:83588073..83588093 59.54 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGTGAGGTCAAAGCAGGA Chr2:83588073..83588093 59.54 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027087