Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25845
Trapped Gene
Sbno2 (ENSMUSG00000035673)
Vector Insertion
Chr 10: 79545472 - 79546985
Public Clones not available
Private Clones OST158413 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311767 (Chr10:79546986..79547059 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGTACCCCACCTTCTCCAG Chr10:79546995..79547014 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311767 (Chr10:79546986..79547059 -)
Downstram Exon
ENSMUSE00000311760 (Chr10:79545360..79545471 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGTACCCCACCTTCTCCAG Chr10:79546995..79547014 59.96 55 CTGAGGAAAGTCGCTGCTCT Chr10:79545338..79545357 59.89 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000455371 Chr10:79565355..79565447 No primer for this exon
upstream ENSMUSE00000311778 Chr10:79549002..79549177 CCAGCACCACAGAGTAAGCA Chr10:79549134..79549153 60.05 55
upstream ENSMUSE00000311767 Chr10:79546986..79547059 TTGTACCCCACCTTCTCCAG Chr10:79546995..79547014 59.96 55

*** Putative Vector Insertion (Chr 10: 79545472 - 79546985) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000311760 Chr10:79545360..79545471 CTGAGGAAAGTCGCTGCTCT Chr10:79545338..79545357 59.89 55
downstream ENSMUSE00000574919 Chr10:79537973..79538184 CCCATTTGCATGAGGGTTAG Chr10:79538132..79538151 60.32 50
downstream ENSMUSE00000311750 Chr10:79535102..79535263 TGTCTGACAGGGAATCCACA Chr10:79535172..79535191 60.09 50
downstream ENSMUSE00000455306 Chr10:79532713..79532796 GTCTTCAGGAGCCGAGAATG Chr10:79532736..79532755 59.95 55
downstream ENSMUSE00000641819 Chr10:79532356..79532452 TCCTCTTCCTCCCCTTCTTC Chr10:79532390..79532409 59.75 55
downstream ENSMUSE00000641818 Chr10:79532027..79532181 GTGGGTAGCGCTAGGGTGTA Chr10:79532063..79532082 60.15 60
downstream ENSMUSE00000311834 Chr10:79531604..79531737 CACTATGATGCCAGCCACTG Chr10:79531617..79531636 60.29 55
downstream ENSMUSE00000312081 Chr10:79531430..79531520 TTGAGGTCATTGGAGGCACT Chr10:79531475..79531494 60.66 50
downstream ENSMUSE00000312072 Chr10:79531073..79531216 TTCTCCAATCAGGGCAGAGT Chr10:79531126..79531145 59.8 50
downstream ENSMUSE00000312064 Chr10:79530022..79530139 TGGCACTCGTCAAACACAAT Chr10:79530098..79530117 60.16 45
downstream ENSMUSE00000312058 Chr10:79529576..79529681 CCAGCCGGCTCATGTATATC Chr10:79529618..79529637 60.46 55
downstream ENSMUSE00000455237 Chr10:79529295..79529448 GCTGCCCGATTATAGACCTG Chr10:79529280..79529299 59.69 55
downstream ENSMUSE00000312041 Chr10:79527065..79527241 AACTGACCCCACAGGGACTT Chr10:79527140..79527159 60.8 55
downstream ENSMUSE00000312033 Chr10:79526890..79526987 CTCGTTCTCATCCAGCACCT Chr10:79526900..79526919 60.41 55
downstream ENSMUSE00000311816 Chr10:79526394..79526473 GTGGAAGGGAAGTGCTTCTG Chr10:79526410..79526429 59.84 55
downstream ENSMUSE00000311904 Chr10:79525313..79525504 CTGGGGATGAATTGAAGTCG Chr10:79525354..79525373 60.45 50
downstream ENSMUSE00000574918 Chr10:79525162..79525504 TGGTTATGTCTGCTGCCTTG Chr10:79525245..79525264 59.86 50
downstream ENSMUSE00000311895 Chr10:79524907..79525076 CTGGTCCAACGTGTTGACTG Chr10:79524924..79524943 60.19 55
downstream ENSMUSE00000311999 Chr10:79524061..79524192 CATCAGGCCTCGATACCACT Chr10:79524131..79524150 60.1 55
downstream ENSMUSE00000311994 Chr10:79523729..79523864 ACTGTTGAATGGCACGGTCT Chr10:79523710..79523729 60.58 50
downstream ENSMUSE00000311986 Chr10:79523534..79523646 ACGTACTCGGGTGCTGAGAC Chr10:79523582..79523601 60.33 60
downstream ENSMUSE00000311979 Chr10:79523335..79523406 TCAGGTCTCGGGACTCAGTG Chr10:79523336..79523355 61.44 60
downstream ENSMUSE00000311970 Chr10:79523139..79523247 GCCCATGATTGTAGCAAGGA Chr10:79523181..79523200 61 50
downstream ENSMUSE00000311963 Chr10:79522910..79522984 CCTTCTCCACATCCAAGCAG Chr10:79522888..79522907 60.79 55
downstream ENSMUSE00000311888 Chr10:79522681..79522824 GATGAGGTGGTCGAAGGTGT Chr10:79522702..79522721 59.97 55
downstream ENSMUSE00000311950 Chr10:79521550..79521644 GAACACCTGCTGGCTTTCTT Chr10:79521573..79521592 59.48 50
downstream ENSMUSE00000311883 Chr10:79521382..79521477 TTGAGCTCCAGCGACCTAGT Chr10:79521394..79521413 60.16 55
downstream ENSMUSE00000311876 Chr10:79521161..79521292 TTGGCTTGTACACGGTGAAA Chr10:79521198..79521217 60.15 45
downstream ENSMUSE00000367649 Chr10:79520998..79521074 GACAGGGCATAGCTGCTCTC Chr10:79521003..79521022 60.13 60
downstream ENSMUSE00000311867 Chr10:79520701..79520891 AAGGCGCACAATCTGTAGGT Chr10:79520707..79520726 59.76 50
downstream ENSMUSE00000311788 Chr10:79519765..79520609 TGAAATTGATGTCGCAGCTC Chr10:79520276..79520295 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000035673