Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25847
Trapped Gene
AL606963.5 (ENSMUSG00000082082)
Vector Insertion
Chr 4: 145037911 - 145039369
Public Clones not available
Private Clones OST158260 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714552 (Chr4:145037790..145037910 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCCTTGGACTTCTCACTTG Chr4:145037807..145037826 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714552 (Chr4:145037790..145037910 +)
Downstram Exon
ENSMUSE00000721428 (Chr4:145039370..145040791 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCCTTGGACTTCTCACTTG Chr4:145037807..145037826 59.84 55 GGGGAGAGCACTTGTCACAT Chr4:145040388..145040407 60.12 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711353 Chr4:145036643..145036674 No primer for this exon
upstream ENSMUSE00000714552 Chr4:145037790..145037910 GGCCTTGGACTTCTCACTTG Chr4:145037807..145037826 59.84 55

*** Putative Vector Insertion (Chr 4: 145037911 - 145039369) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000721428 Chr4:145039370..145040791 GGGGAGAGCACTTGTCACAT Chr4:145040388..145040407 60.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTTCCTTAATCGCCTTGC Chr4:145037954..145037974 58.83 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGTTTTCCTCGTGACTGG Chr4:145037951..145037971 58.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000082082