Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25848
Trapped Gene
2210404O07Rik (ENSMUSG00000078439)
Vector Insertion
Chr 10: 80855905 - 80856528
Public Clones not available
Private Clones OST158250 (lexicon) OST158238 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000665816 (Chr10:80855796..80855904 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTGCTGGCTACACTGTTC Chr10:80855860..80855879 60.21 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000665816 (Chr10:80855796..80855904 +)
Downstram Exon
ENSMUSE00000609218 (Chr10:80856529..80856640 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTGCTGGCTACACTGTTC Chr10:80855860..80855879 60.21 55 AACAGGAAGCCCACTACTGC Chr10:80856592..80856611 59.36 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665816 Chr10:80855796..80855904 TGCTGCTGGCTACACTGTTC Chr10:80855860..80855879 60.21 55

*** Putative Vector Insertion (Chr 10: 80855905 - 80856528) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000720291 Chr10:80856372..80856640 TTCTGCGAGAGGGAAAAAGA Chr10:80856455..80856474 60.07 45
downstream ENSMUSE00000609218 Chr10:80856529..80856640 AACAGGAAGCCCACTACTGC Chr10:80856592..80856611 59.36 55
downstream ENSMUSE00000665815 Chr10:80856833..80856895 No primer for this exon
downstream ENSMUSE00000665814 Chr10:80857521..80858136 TCAGAAAAGAACCCGGTGAC Chr10:80858020..80858039 60.09 50
downstream ENSMUSE00000719466 Chr10:80857521..80858137 TCAGAAAAGAACCCGGTGAC Chr10:80858020..80858039 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGCTGGCTACACTGTTC Chr10:80855861..80855881 60.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTGCTGGCTACACTGTTC Chr10:80855861..80855881 60.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078439