Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25849
Trapped Gene
Phgdh (ENSMUSG00000053398)
Vector Insertion
Chr 3: 98118329 - 98118987
Public Clones not available
Private Clones OST158188 (lexicon)
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000516736 (Chr3:98118988..98119118 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGACGTGAACTTGGTGAA Chr3:98119022..98119041 59.88 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000516736 (Chr3:98118988..98119118 -)
Downstram Exon
ENSMUSE00000428450 (Chr3:98118091..98118328 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGACGTGAACTTGGTGAA Chr3:98119022..98119041 59.88 50 TCTGAAGACAGCTCCGTTGA Chr3:98118154..98118173 59.7 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000565980 Chr3:98143618..98143847 GGAAGATCCTGCAAGATGGA Chr3:98143678..98143697 60.16 50
upstream ENSMUSE00000496974 Chr3:98138430..98138581 ACAGGTGTGGACAATGTGGA Chr3:98138469..98138488 59.85 50
upstream ENSMUSE00000565979 Chr3:98137158..98137223 ACCTGTGGGATGATCATGTG Chr3:98137167..98137186 59.18 50
upstream ENSMUSE00000493784 Chr3:98132212..98132266 TCGATGAAAGATGGCAAATG Chr3:98132225..98132244 59.62 40
upstream ENSMUSE00000565978 Chr3:98131970..98132068 CGAATGCAATCCTTTGGAAT Chr3:98131974..98131993 59.9 40
upstream ENSMUSE00000428469 Chr3:98125136..98125268 GGAGGAGATCTGGCCTCTCT Chr3:98125181..98125200 59.91 60
upstream ENSMUSE00000488913 Chr3:98124569..98124717 TCAGTGCAAGAAAGGTGTGC Chr3:98124673..98124692 60.03 50
upstream ENSMUSE00000460367 Chr3:98123543..98123695 GCCTTAGTGGACCACGAGAA Chr3:98123658..98123677 60.26 55
upstream ENSMUSE00000512904 Chr3:98120329..98120461 CCTAAAGGGACCATCCAGGT Chr3:98120340..98120359 60.18 55
upstream ENSMUSE00000516736 Chr3:98118988..98119118 GCAGACGTGAACTTGGTGAA Chr3:98119022..98119041 59.88 50

*** Putative Vector Insertion (Chr 3: 98118329 - 98118987) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000428450 Chr3:98118091..98118328 TCTGAAGACAGCTCCGTTGA Chr3:98118154..98118173 59.7 50
downstream ENSMUSE00000565977 Chr3:98117094..98117380 AGCCTCCAATACATGCTGCT Chr3:98117222..98117241 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000053398