Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25861
Trapped Gene
Ranbp17 (ENSMUSG00000040594)
Vector Insertion
Chr 11: 33400771 - 33404681
Public Clones not available
Private Clones OST157146 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662692 (Chr11:33404682..33404828 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGACCGATCTCACTGAAAG Chr11:33404767..33404786 59.65 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662692 (Chr11:33404682..33404828 -)
Downstram Exon
ENSMUSE00000251467 (Chr11:33400680..33400770 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGACCGATCTCACTGAAAG Chr11:33404767..33404786 59.65 55 AGACATGTTGCTGCAAGGAG Chr11:33400714..33400733 59.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662693 Chr11:33413602..33413635 No primer for this exon
upstream ENSMUSE00000679977 Chr11:33413602..33413630 No primer for this exon
upstream ENSMUSE00000662692 Chr11:33404682..33404828 GGGACCGATCTCACTGAAAG Chr11:33404767..33404786 59.65 55

*** Putative Vector Insertion (Chr 11: 33400771 - 33404681) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251467 Chr11:33400680..33400770 AGACATGTTGCTGCAAGGAG Chr11:33400714..33400733 59.04 50
downstream ENSMUSE00000251462 Chr11:33393251..33393417 GTTGGGACGCCACATAATTC Chr11:33393363..33393382 60.2 50
downstream ENSMUSE00000251454 Chr11:33391327..33391392 CACTCCTATTATGCAGTGTTCCA Chr11:33391341..33391363 59.17 43.48
downstream ENSMUSE00000251447 Chr11:33387643..33387747 TGTTTTGCTGAAGGTCTGGA Chr11:33387697..33387716 59.42 45
downstream ENSMUSE00000336965 Chr11:33385918..33386083 GCCCAGGAAGTCAAAGTTCA Chr11:33385960..33385979 60.23 50
downstream ENSMUSE00000251437 Chr11:33383006..33383079 GGTGGGAGCGAGTGATACAA Chr11:33383000..33383019 61.07 55
downstream ENSMUSE00000251426 Chr11:33381022..33381141 No primer for this exon
downstream ENSMUSE00000251419 Chr11:33379143..33379289 AAACGAGCCAAAAATCGACA Chr11:33379215..33379234 60.62 40
downstream ENSMUSE00000251411 Chr11:33378164..33378336 ATTCCAAACGGGACGTGATA Chr11:33378161..33378180 60.19 45
downstream ENSMUSE00000251406 Chr11:33374887..33375080 GGAACACGGTAGCAGTGTCA Chr11:33375015..33375034 59.75 55
downstream ENSMUSE00000679976 Chr11:33372416..33375080 GAAATGCCACCAGCCTACAT Chr11:33373562..33373581 59.96 50
downstream ENSMUSE00000251401 Chr11:33352444..33352549 CGGCAGGATAGTTCTCCATC Chr11:33352422..33352441 59.65 55
downstream ENSMUSE00000251395 Chr11:33341803..33341938 TCTCATTGGTGCAGTGAGGT Chr11:33341861..33341880 59.26 50
downstream ENSMUSE00000251393 Chr11:33229471..33229544 TTCGTCATGAATGTTTCCAGA Chr11:33229452..33229472 59.11 38.1
downstream ENSMUSE00000662691 Chr11:33228444..33228524 GAACTGAAGCGTCCTGGAGA Chr11:33228442..33228461 60.53 55
downstream ENSMUSE00000662690 Chr11:33218428..33218491 TCAGCATGAATTTCACAGCA Chr11:33218417..33218436 58.94 40
downstream ENSMUSE00000251374 Chr11:33218239..33218347 TACCATCAGAAGGCGAGTGA Chr11:33218224..33218243 59.39 50
downstream ENSMUSE00000405819 Chr11:33202767..33202870 AGAGACTGTGAGAGGCAGCA Chr11:33202799..33202818 58.86 55
downstream ENSMUSE00000251358 Chr11:33197342..33197430 TGTTCAGTGCAAAGGCAATC Chr11:33197354..33197373 59.85 45
downstream ENSMUSE00000251350 Chr11:33189564..33189671 TGCATCAGTTCTGCCAAGAG Chr11:33189548..33189567 60.14 50
downstream ENSMUSE00000251342 Chr11:33183908..33183990 TCATTTTGCTGGCTTCTCTG Chr11:33183898..33183917 59.15 45
downstream ENSMUSE00000251336 Chr11:33166110..33166324 ATGCCCTTGAGTTTCATTGG Chr11:33166236..33166255 59.93 45
downstream ENSMUSE00000251331 Chr11:33164636..33164774 GTGGTCCTGGGTGAGACATT Chr11:33164693..33164712 59.82 55
downstream ENSMUSE00000406897 Chr11:33143110..33143276 AGTCTCTGACCAGCCTGCAT Chr11:33143128..33143147 60.02 55
downstream ENSMUSE00000251644 Chr11:33119171..33119269 GACCACTGGTTCCGACAATC Chr11:33119192..33119211 60.37 55
downstream ENSMUSE00000251640 Chr11:33117292..33117419 ATCAGACTGGCCCTCAGTTC Chr11:33117369..33117388 59.26 55
downstream ENSMUSE00000662689 Chr11:33112422..33113498 AGGTTTGATGGGTCACAAGC Chr11:33112504..33112523 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:33404610..33404630 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000040594