Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25876
Trapped Gene
EG632778 (ENSMUSG00000074261)
Vector Insertion
Chr 7: 26400320 - 26400681
Public Clones not available
Private Clones OST155197 (lexicon) OST151755 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636352 (Chr7:26400682..26400911 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGGGTCACTTGGACCTTG Chr7:26400889..26400908 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636352 (Chr7:26400682..26400911 -)
Downstram Exon
ENSMUSE00000636351 (Chr7:26399640..26400319 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGGGTCACTTGGACCTTG Chr7:26400889..26400908 60 55 CGTTCTTCGTCCTGCTTCTC Chr7:26400116..26400135 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636352 Chr7:26400682..26400911 ACTGGGTCACTTGGACCTTG Chr7:26400889..26400908 60 55

*** Putative Vector Insertion (Chr 7: 26400320 - 26400681) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636351 Chr7:26399640..26400319 CGTTCTTCGTCCTGCTTCTC Chr7:26400116..26400135 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTAATCGCCTTGCAGCAC Chr7:26400613..26400633 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000074261