Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25881
Trapped Gene
Tnrc6c (ENSMUSG00000025571)
Vector Insertion
Chr 11: 117562139 - 117563692
Public Clones not available
Private Clones OST155002 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000588355 (Chr11:117562039..117562138 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGAACGTTTGATGGAAGAA Chr11:117562064..117562084 59.16 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000588355 (Chr11:117562039..117562138 +)
Downstram Exon
ENSMUSE00000669555 (Chr11:117563693..117563714 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGAACGTTTGATGGAAGAA Chr11:117562064..117562084 59.16 42.86 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669557 Chr11:117515603..117516000 CGGGTATTAGGGGAGAAGGA Chr11:117515884..117515903 60.27 55
upstream ENSMUSE00000669544 Chr11:117516127..117516645 No primer for this exon
upstream ENSMUSE00000588355 Chr11:117562039..117562138 GAGGAACGTTTGATGGAAGAA Chr11:117562064..117562084 59.16 42.86
upstream ENSMUSE00000719540 Chr11:117562039..117562138 GAGGAACGTTTGATGGAAGAA Chr11:117562064..117562084 59.16 42.86

*** Putative Vector Insertion (Chr 11: 117562139 - 117563692) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000669555 Chr11:117563693..117563714 No primer for this exon
downstream ENSMUSE00000585375 Chr11:117575440..117575766 GCTGCCGCTAGAAATAGTGC Chr11:117575531..117575550 60.15 55
downstream ENSMUSE00000369101 Chr11:117582264..117584864 GCTTATGAGCCCAGTTCTGC Chr11:117584495..117584514 59.99 55
downstream ENSMUSE00000387326 Chr11:117593482..117593694 CCAGGGTACAAGGGGAAGAT Chr11:117593568..117593587 60.18 55
downstream ENSMUSE00000246693 Chr11:117594924..117595090 GCAGGATGAGCTGCTTTCTT Chr11:117595054..117595073 59.72 50
downstream ENSMUSE00000377801 Chr11:117597286..117597366 GGAAGCCCATGTCTGTGAGT Chr11:117597367..117597386 60.12 55
downstream ENSMUSE00000246673 Chr11:117599605..117599662 GGCCTGGTCAAGGTTCATAC Chr11:117599661..117599680 59.41 55
downstream ENSMUSE00000246665 Chr11:117601181..117601323 TAGTCGGTCATTCCCAGTCC Chr11:117601241..117601260 59.93 55
downstream ENSMUSE00000363199 Chr11:117602959..117603132 GCCATCCTGATTGGAGAAAG Chr11:117602991..117603010 59.63 50
downstream ENSMUSE00000406457 Chr11:117604241..117604378 GGCTGGGAGGAATTAAGAGG Chr11:117604341..117604360 60.03 55
downstream ENSMUSE00000364572 Chr11:117608491..117608610 GAGCTGGTTCAACATCGTCA Chr11:117608598..117608617 59.84 50
downstream ENSMUSE00000151711 Chr11:117610558..117610641 CTGGGCCTGTAACATCTGCT Chr11:117610605..117610624 60.28 55
downstream ENSMUSE00000349816 Chr11:117610891..117611131 AGGTGTTGGGTGAAGACTGC Chr11:117611116..117611135 60.16 55
downstream ENSMUSE00000382209 Chr11:117614291..117614458 GGAGTTGGGATGTGTCCACT Chr11:117614406..117614425 59.82 55
downstream ENSMUSE00000151708 Chr11:117616645..117616836 TACCGGCCGTAAGAGTCATC Chr11:117616717..117616736 60.1 55
downstream ENSMUSE00000246537 Chr11:117617277..117617420 AGGTAGCGGTTGACATCCTG Chr11:117617409..117617428 60.13 55
downstream ENSMUSE00000408588 Chr11:117619251..117619445 TTCTGGGTACCTTCCACAGC Chr11:117619346..117619365 60.11 55
downstream ENSMUSE00000151706 Chr11:117620218..117620288 GAGCCAGCTGCTTGTTCTTC Chr11:117620267..117620286 60.28 55
downstream ENSMUSE00000575390 Chr11:117620938..117621077 CACAGCGTCCGAAGTGTAGA Chr11:117620969..117620988 60.05 55
downstream ENSMUSE00000401973 Chr11:117621805..117624751 ACGAAACGAGGGTAATGTGC Chr11:117622668..117622687 60 50
downstream ENSMUSE00000669543 Chr11:117621805..117624753 ACGAAACGAGGGTAATGTGC Chr11:117622668..117622687 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTCCTGGGTCGTGTCTGT Chr11:117562165..117562185 60.71 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCCTGGGTCGTGTCTGT Chr11:117562165..117562185 60.71 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025571