Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25890
Trapped Gene
Usp19 (ENSMUSG00000006676)
Vector Insertion
Chr 9: 108393227 - 108394801
Public Clones CMHD-GT_534G5-3 (cmhd) IST14403G5 (tigm)
Private Clones OST154276 (lexicon) OST147661 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634288 (Chr9:108393079..108393226 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634288 (Chr9:108393079..108393226 +)
Downstram Exon
ENSMUSE00000634287 (Chr9:108394802..108395061 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634288 Chr9:108393079..108393226 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108393227 - 108394801) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000634287 Chr9:108394802..108395061 No primer for this exon
downstream ENSMUSE00000486864 Chr9:108395299..108395331 No primer for this exon
downstream ENSMUSE00000489783 Chr9:108395467..108395595 No primer for this exon
downstream ENSMUSE00000471190 Chr9:108395681..108395814 No primer for this exon
downstream ENSMUSE00000470181 Chr9:108395895..108396194 No primer for this exon
downstream ENSMUSE00000469133 Chr9:108396347..108396569 No primer for this exon
downstream ENSMUSE00000448953 Chr9:108396698..108396854 No primer for this exon
downstream ENSMUSE00000350434 Chr9:108396958..108397029 No primer for this exon
downstream ENSMUSE00000242972 Chr9:108397143..108397258 No primer for this exon
downstream ENSMUSE00000242956 Chr9:108397365..108397585 No primer for this exon
downstream ENSMUSE00000242929 Chr9:108397868..108398063 No primer for this exon
downstream ENSMUSE00000221459 Chr9:108398142..108398275 No primer for this exon
downstream ENSMUSE00000221446 Chr9:108398401..108398559 No primer for this exon
downstream ENSMUSE00000221463 Chr9:108398636..108398746 No primer for this exon
downstream ENSMUSE00000221457 Chr9:108399183..108399293 No primer for this exon
downstream ENSMUSE00000221456 Chr9:108399397..108399498 No primer for this exon
downstream ENSMUSE00000221462 Chr9:108400227..108400367 No primer for this exon
downstream ENSMUSE00000221467 Chr9:108400454..108400572 No primer for this exon
downstream ENSMUSE00000448849 Chr9:108400773..108400910 No primer for this exon
downstream ENSMUSE00000221458 Chr9:108401011..108401324 No primer for this exon
downstream ENSMUSE00000448275 Chr9:108401426..108401536 No primer for this exon
downstream ENSMUSE00000221447 Chr9:108401625..108401841 No primer for this exon
downstream ENSMUSE00000221460 Chr9:108401923..108402075 No primer for this exon
downstream ENSMUSE00000221468 Chr9:108402181..108402341 No primer for this exon
downstream ENSMUSE00000221450 Chr9:108402422..108402600 No primer for this exon
downstream ENSMUSE00000392267 Chr9:108403525..108404028 No primer for this exon
downstream ENSMUSE00000529771 Chr9:108404171..108404287 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr9:108393277..108393297 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGCCGTGACTGGGAAAAC Chr9:108393273..108393293 63.57 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006676