Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25898
Trapped Gene
Rexo4 (ENSMUSG00000052406)
Vector Insertion
Chr 2: 26819571 - 26819833
Public Clones not available
Private Clones OST153522 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706961 (Chr2:26819572..26819838 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGAAGCTCGCTAGGAAGA Chr2:26819706..26819725 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706961 (Chr2:26819572..26819838 -)
Downstram Exon
ENSMUSE00000706960 (Chr2:26819572..26819832 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGAAGCTCGCTAGGAAGA Chr2:26819706..26819725 59.85 55 TCTTCCTAGCGAGCTTCCTG Chr2:26819684..26819703 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000232615 Chr2:26819572..26819906 CAGGAAGCTCGCTAGGAAGA Chr2:26819706..26819725 59.85 55
upstream ENSMUSE00000706960 Chr2:26819572..26819832 CAGGAAGCTCGCTAGGAAGA Chr2:26819706..26819725 59.85 55
upstream ENSMUSE00000706961 Chr2:26819572..26819838 CAGGAAGCTCGCTAGGAAGA Chr2:26819706..26819725 59.85 55

*** Putative Vector Insertion (Chr 2: 26819571 - 26819833) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000517801 Chr2:26817903..26818243 CTTGAGAGCCCCTTGATGAG Chr2:26817937..26817956 59.94 55
downstream ENSMUSE00000518782 Chr2:26816123..26816260 GGCCTATGGCATCCTCAATA Chr2:26816183..26816202 59.88 50
downstream ENSMUSE00000519992 Chr2:26815744..26815937 ACTGGTTCACGATCGACACA Chr2:26815821..26815840 60.16 50
downstream ENSMUSE00000232588 Chr2:26813999..26814087 CTGCCCTTCAACATTTCTGC Chr2:26814014..26814033 60.78 50
downstream ENSMUSE00000232582 Chr2:26811809..26811883 TCGACTCCTGAATGGTTTGA Chr2:26811793..26811812 59.22 45
downstream ENSMUSE00000232578 Chr2:26811015..26811089 GACCCTGATCCCCAGAATTT Chr2:26811014..26811033 60.13 50
downstream ENSMUSE00000697781 Chr2:26809086..26810116 AGAGTTCTTGATGCGGTGCT Chr2:26809978..26809997 60.02 50
downstream ENSMUSE00000232572 Chr2:26809083..26810116 AGAGTTCTTGATGCGGTGCT Chr2:26809978..26809997 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCGACTGTAATCGCCTTG Chr2:26819771..26819791 61.16 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCTGGGAAATGTGTGCTT Chr2:26819827..26819847 61.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052406