Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25903
Trapped Gene
Dennd1c (ENSMUSG00000002668)
Vector Insertion
Chr 17: 57214912 - 57216069
Public Clones not available
Private Clones OST153144 (lexicon) OST153091 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000139908 (Chr17:57216070..57216119 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000139908 (Chr17:57216070..57216119 -)
Downstram Exon
ENSMUSE00000139901 (Chr17:57214792..57214911 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693642 Chr17:57217813..57217933 No primer for this exon
upstream ENSMUSE00000139913 Chr17:57216364..57216428 No primer for this exon
upstream ENSMUSE00000139911 Chr17:57216241..57216284 No primer for this exon
upstream ENSMUSE00000139908 Chr17:57216070..57216119 No primer for this exon

*** Putative Vector Insertion (Chr 17: 57214912 - 57216069) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139901 Chr17:57214792..57214911 No primer for this exon
downstream ENSMUSE00000139909 Chr17:57213916..57213985 No primer for this exon
downstream ENSMUSE00000139902 Chr17:57213697..57213777 No primer for this exon
downstream ENSMUSE00000139910 Chr17:57213537..57213602 No primer for this exon
downstream ENSMUSE00000139907 Chr17:57213397..57213450 No primer for this exon
downstream ENSMUSE00000376025 Chr17:57213196..57213306 No primer for this exon
downstream ENSMUSE00000364073 Chr17:57211759..57211859 No primer for this exon
downstream ENSMUSE00000401695 Chr17:57211432..57211477 No primer for this exon
downstream ENSMUSE00000442148 Chr17:57211211..57211312 No primer for this exon
downstream ENSMUSE00000404331 Chr17:57210995..57211120 No primer for this exon
downstream ENSMUSE00000281024 Chr17:57210342..57210446 No primer for this exon
downstream ENSMUSE00000280996 Chr17:57209953..57210046 No primer for this exon
downstream ENSMUSE00000280976 Chr17:57209831..57209871 No primer for this exon
downstream ENSMUSE00000280954 Chr17:57209536..57209607 No primer for this exon
downstream ENSMUSE00000345589 Chr17:57207340..57207372 No primer for this exon
downstream ENSMUSE00000406370 Chr17:57207212..57207256 No primer for this exon
downstream ENSMUSE00000442112 Chr17:57207016..57207123 No primer for this exon
downstream ENSMUSE00000409337 Chr17:57206472..57206539 No primer for this exon
downstream ENSMUSE00000348612 Chr17:57206155..57206365 No primer for this exon
downstream ENSMUSE00000384973 Chr17:57205479..57206064 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGGCACACACACTCTTTG Chr17:57216029..57216049 60.2 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGGCACACACACTCTTTG Chr17:57216029..57216049 60.2 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002668