Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25915
Trapped Gene
OTTMUSG00000007332 (ENSMUSG00000038578)
Vector Insertion
Chr 4: 59403625 - 59424141
Public Clones not available
Private Clones OST151581 (lexicon) OST64063 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000323171 (Chr4:59424142..59424321 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGGTTTCTCAGCGTCTCA Chr4:59424206..59424225 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000323171 (Chr4:59424142..59424321 -)
Downstram Exon
ENSMUSE00000323161 (Chr4:59403445..59403624 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGGTTTCTCAGCGTCTCA Chr4:59424206..59424225 59.99 50 TCTCTGTGCAAACGGAAGTG Chr4:59403459..59403478 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673558 Chr4:59451078..59451505 CCTAGCACAGTCCGCTTTCT Chr4:59451390..59451409 59.64 55
upstream ENSMUSE00000673543 Chr4:59440827..59440899 ACTATGGGTTTTGGGGCAAC Chr4:59440842..59440861 60.97 50
upstream ENSMUSE00000673557 Chr4:59440827..59440936 ACTATGGGTTTTGGGGCAAC Chr4:59440842..59440861 60.97 50
upstream ENSMUSE00000673555 Chr4:59436867..59437022 CAATGACGGCACTTTCTGTG Chr4:59436870..59436889 60.3 50
upstream ENSMUSE00000632505 Chr4:59425042..59425194 AGGGCGGTGTGTCAATACTC Chr4:59425135..59425154 60 55
upstream ENSMUSE00000323171 Chr4:59424142..59424321 AAGGGTTTCTCAGCGTCTCA Chr4:59424206..59424225 59.99 50

*** Putative Vector Insertion (Chr 4: 59403625 - 59424141) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000323161 Chr4:59403445..59403624 TCTCTGTGCAAACGGAAGTG Chr4:59403459..59403478 60.03 50
downstream ENSMUSE00000323155 Chr4:59393733..59393830 AGTACACGATCCTGGCGTTC Chr4:59393713..59393732 60.14 55
downstream ENSMUSE00000323147 Chr4:59392471..59392657 CATAAACTGATTCCGCAGCA Chr4:59392590..59392609 59.83 45
downstream ENSMUSE00000323142 Chr4:59382403..59382512 TAGAGTGCCTGCTCAACGTC Chr4:59382410..59382429 59.19 55
downstream ENSMUSE00000323135 Chr4:59378594..59378786 TCTGGAGCTCGGTCTCTTGT Chr4:59378679..59378698 60.13 55
downstream ENSMUSE00000323129 Chr4:59364510..59364601 GTCTTGAGGCTGCTCCATCT Chr4:59364513..59364532 59.56 55
downstream ENSMUSE00000323124 Chr4:59362698..59362884 GCTGCTGCTGGTTGTATTGA Chr4:59362788..59362807 60.02 50
downstream ENSMUSE00000323114 Chr4:59345809..59345905 GACTTTCCTCAGCGTGAAGC Chr4:59345810..59345829 60.14 55
downstream ENSMUSE00000323105 Chr4:59342335..59342593 ACGTGTCGTCTGGAACATCA Chr4:59342423..59342442 60.16 50
downstream ENSMUSE00000673547 Chr4:59337740..59337779 TTTACCTCAGCCCAGACAGC Chr4:59337720..59337739 60.4 55
downstream ENSMUSE00000705880 Chr4:59328584..59328677 GAATGCAAGGATGGTCACAA Chr4:59328582..59328601 59.5 45
downstream ENSMUSE00000673542 Chr4:59328267..59328281 No primer for this exon
downstream ENSMUSE00000673545 Chr4:59327626..59328281 TGTGGCCTGTGGTGTTACAT Chr4:59327992..59328011 59.88 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCTCTTCACTCTGGGAAA Chr4:59415166..59415186 59.77 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCTAGGTTGCTCGTGACT Chr4:59421083..59421103 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038578