Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25917
Trapped Gene
Pcsk6 (ENSMUSG00000030513)
Vector Insertion
Chr 7: 73007330 - 73055087
Public Clones D124B09 (ggtc) IST11498H1 (tigm) IST10066F5 (tigm) IST12330H12 (tigm)
IST14766E3 (tigm) IST10915F9 (tigm) IST14766E3 (tigm) IST12321E6 (tigm)
IST12762H11 (tigm) IST11444D12 (tigm) IST11609C1 (tigm) IST14223F1 (tigm)
IST11502A6 (tigm) IST12817A7 (tigm) IST11502A6 (tigm) IST11016F2 (tigm)
IST10809H7 (tigm) IST11324H3 (tigm) IST10347G5 (tigm) IST10809H7 (tigm)
IST12330H12 (tigm) IST12836G9 (tigm) IST11524G1 (tigm) IST12836G9 (tigm)
IST14927G9 (tigm) IST14866F4 (tigm) IST14708C9 (tigm) IST11043B4 (tigm)
IST11557B8 (tigm) IST10389G2 (tigm)
Private Clones OST151551 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000512425 (Chr7:73007099..73007329 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCGTCTACACCAACCACTG Chr7:73007234..73007253 61.42 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000512425 (Chr7:73007099..73007329 +)
Downstram Exon
ENSMUSE00000510369 (Chr7:73055088..73055192 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCGTCTACACCAACCACTG Chr7:73007234..73007253 61.42 60 GGGTCCATTCTGAGGAAGGT Chr7:73055191..73055210 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512425 Chr7:73007099..73007329 CCCGTCTACACCAACCACTG Chr7:73007234..73007253 61.42 60

*** Putative Vector Insertion (Chr 7: 73007330 - 73055087) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000510369 Chr7:73055088..73055192 GGGTCCATTCTGAGGAAGGT Chr7:73055191..73055210 60.31 55
downstream ENSMUSE00000199998 Chr7:73072080..73072184 TCTCTTGACTCTGCGCTTCA Chr7:73072127..73072146 60.01 50
downstream ENSMUSE00000673315 Chr7:73072113..73072184 AGACCAAATGGGATCATTGAA Chr7:73072171..73072191 59.23 38.1
downstream ENSMUSE00000199990 Chr7:73072702..73072845 GACCGACAGCGACTGTTCTT Chr7:73072736..73072755 60.45 55
downstream ENSMUSE00000673314 Chr7:73072702..73072845 GACCGACAGCGACTGTTCTT Chr7:73072736..73072755 60.45 55
downstream ENSMUSE00000199980 Chr7:73073993..73074069 TATCTCGGGGATGGGTCATA Chr7:73074051..73074070 60.11 50
downstream ENSMUSE00000673313 Chr7:73073993..73074069 TATCTCGGGGATGGGTCATA Chr7:73074051..73074070 60.11 50
downstream ENSMUSE00000199984 Chr7:73076563..73076651 CCCACGATGCAGTAGGAGTT Chr7:73076628..73076647 60.13 55
downstream ENSMUSE00000673312 Chr7:73076563..73076651 CCCACGATGCAGTAGGAGTT Chr7:73076628..73076647 60.13 55
downstream ENSMUSE00000199995 Chr7:73097805..73097977 AACTGGCGCTGTAAATGTCA Chr7:73097900..73097919 59.35 45
downstream ENSMUSE00000673310 Chr7:73097805..73097977 AACTGGCGCTGTAAATGTCA Chr7:73097900..73097919 59.35 45
downstream ENSMUSE00000199996 Chr7:73103983..73104195 TTGGTGTAGCCATCACAGGA Chr7:73104074..73104093 60.11 50
downstream ENSMUSE00000673309 Chr7:73103983..73104195 TTGGTGTAGCCATCACAGGA Chr7:73104074..73104093 60.11 50
downstream ENSMUSE00000199986 Chr7:73107790..73107890 GCAATGATACCAGCCACCAT Chr7:73107875..73107894 60.75 50
downstream ENSMUSE00000673308 Chr7:73107790..73107890 GCAATGATACCAGCCACCAT Chr7:73107875..73107894 60.75 50
downstream ENSMUSE00000199987 Chr7:73113854..73113957 CTCCGTTGACTTTCCAGTCG Chr7:73113948..73113967 60.82 55
downstream ENSMUSE00000673307 Chr7:73113854..73113957 CTCCGTTGACTTTCCAGTCG Chr7:73113948..73113967 60.82 55
downstream ENSMUSE00000200005 Chr7:73115428..73115545 CCACCAAGCCAAATCCATAG Chr7:73115460..73115479 60.32 50
downstream ENSMUSE00000673306 Chr7:73115428..73115545 CCACCAAGCCAAATCCATAG Chr7:73115460..73115479 60.32 50
downstream ENSMUSE00000433616 Chr7:73125033..73125221 TCCGTAGCACCTGCACTATG Chr7:73125064..73125083 59.89 55
downstream ENSMUSE00000673305 Chr7:73125033..73125221 TCCGTAGCACCTGCACTATG Chr7:73125064..73125083 59.89 55
downstream ENSMUSE00000433653 Chr7:73128599..73128735 CAGAGTCCACTCCCCTTCAG Chr7:73128692..73128711 59.83 60
downstream ENSMUSE00000673304 Chr7:73128599..73128735 CAGAGTCCACTCCCCTTCAG Chr7:73128692..73128711 59.83 60
downstream ENSMUSE00000464622 Chr7:73170114..73170293 TGCGGTGCCATATAAAATGA Chr7:73170157..73170176 59.92 40
downstream ENSMUSE00000673303 Chr7:73170114..73170293 TGCGGTGCCATATAAAATGA Chr7:73170157..73170176 59.92 40
downstream ENSMUSE00000634290 Chr7:73170452..73170490 TTAGGAGAGCCTTGGATGGA Chr7:73170479..73170498 59.77 50
downstream ENSMUSE00000264314 Chr7:73176635..73176737 CAGTTCAAGCACTGGTCTGC Chr7:73176704..73176723 59.62 55
downstream ENSMUSE00000264305 Chr7:73178636..73178832 CACACACGTGTTCGTCTCCT Chr7:73178801..73178820 59.78 55
downstream ENSMUSE00000264297 Chr7:73180067..73180154 AGGTTCATCCACGCACTTCT Chr7:73180125..73180144 59.73 50
downstream ENSMUSE00000264283 Chr7:73183867..73183970 TGACGAGCTCTGAATCGAAG Chr7:73183934..73183953 59.27 50
downstream ENSMUSE00000264275 Chr7:73188401..73188530 TCGACACACTTTGTGGGGTA Chr7:73188531..73188550 60 50
downstream ENSMUSE00000264267 Chr7:73192443..73192555 CAGCTCAGGCAGTTCTCCTC Chr7:73192469..73192488 60.28 60
downstream ENSMUSE00000402736 Chr7:73193792..73195220 GTTTCGGAAGGAGCTGACTG Chr7:73194501..73194520 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCAGGCTCTGCTTTGGTT Chr7:73025339..73025359 60.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCAGGCTCTGCTTTGGTT Chr7:73025339..73025359 60.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030513