Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25921
Trapped Gene
Ghrh (ENSMUSG00000027643)
Vector Insertion
Chr 2: 157159216 - 157159428
Public Clones not available
Private Clones OST151105 (lexicon) OST150050 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000316867 (Chr2:157159429..157159528 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGTGCTCTTTGTGATCCTC Chr2:157159479..157159498 59.66 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000316867 (Chr2:157159429..157159528 -)
Downstram Exon
ENSMUSE00000171437 (Chr2:157159114..157159215 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGTGCTCTTTGTGATCCTC Chr2:157159479..157159498 59.66 55 ATCACTTTCCGGGCATACAG Chr2:157159116..157159135 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411777 Chr2:157172308..157172391 No primer for this exon
upstream ENSMUSE00000680658 Chr2:157163092..157163162 GCAGAACCTCAATCGGAGAG Chr2:157163112..157163131 59.95 55
upstream ENSMUSE00000316867 Chr2:157159429..157159528 GGGTGCTCTTTGTGATCCTC Chr2:157159479..157159498 59.66 55

*** Putative Vector Insertion (Chr 2: 157159216 - 157159428) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171437 Chr2:157159114..157159215 ATCACTTTCCGGGCATACAG Chr2:157159116..157159135 59.96 50
downstream ENSMUSE00000171435 Chr2:157157515..157157605 ATGCTCTCCAGGGTCATCTG Chr2:157157497..157157516 60.22 55
downstream ENSMUSE00000171434 Chr2:157155233..157155371 CAGAGGACGGAAAAGGTCAG Chr2:157155242..157155261 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCTCCCTTCAGGTAAGCA Chr2:157159420..157159440 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCTCCCTTCAGGTAAGCA Chr2:157159420..157159440 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027643