Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25927
Trapped Gene
Ttyh2 (ENSMUSG00000034714)
Vector Insertion
Chr 11: 114551665 - 114557902
Public Clones not available
Private Clones OST150623 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000259272 (Chr11:114551553..114551664 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAACAGCGAGACCAACGAT Chr11:114551579..114551598 60.26 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000259272 (Chr11:114551553..114551664 +)
Downstram Exon
ENSMUSE00000259259 (Chr11:114557903..114558123 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAACAGCGAGACCAACGAT Chr11:114551579..114551598 60.26 50 TCCACATAGGCAGTCTGGTG Chr11:114558117..114558136 59.7 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000259295 Chr11:114536831..114536986 CTGCAGCGAGTAGACAGCAC Chr11:114536936..114536955 59.95 60
upstream ENSMUSE00000259283 Chr11:114547708..114547880 CCTCACCGTCTACCTGGTGT Chr11:114547764..114547783 60.03 60
upstream ENSMUSE00000259272 Chr11:114551553..114551664 GAAACAGCGAGACCAACGAT Chr11:114551579..114551598 60.26 50

*** Putative Vector Insertion (Chr 11: 114551665 - 114557902) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000259259 Chr11:114557903..114558123 TCCACATAGGCAGTCTGGTG Chr11:114558117..114558136 59.7 55
downstream ENSMUSE00000259247 Chr11:114563095..114563190 AGGTGACAAGGCAGATGACC Chr11:114563153..114563172 60.12 55
downstream ENSMUSE00000259237 Chr11:114563550..114563622 TCAGGGTCAGTATTCCACAGC Chr11:114563580..114563600 60.13 52.38
downstream ENSMUSE00000259225 Chr11:114568650..114568719 GTTGATCTGGCTCCCTGTGT Chr11:114568718..114568737 60.12 55
downstream ENSMUSE00000259216 Chr11:114568993..114569048 GCTCTGACTGCAATGGAGGT Chr11:114569030..114569049 60.42 55
downstream ENSMUSE00000259203 Chr11:114569731..114569823 GATCTGCATGGTGGTCAATG Chr11:114569775..114569794 59.92 50
downstream ENSMUSE00000259191 Chr11:114570083..114570175 CAGGCTGATCTCGGAGTTGT Chr11:114570136..114570155 60.41 55
downstream ENSMUSE00000259185 Chr11:114571357..114571499 CCAGTGAGGGCGTCTAGGTA Chr11:114571382..114571401 60.27 60
downstream ENSMUSE00000259177 Chr11:114572125..114572310 GTTGAAAGGGTCATCGTCGT Chr11:114572170..114572189 59.97 50
downstream ENSMUSE00000259170 Chr11:114573074..114573152 TGGGTTCCCACCAAAGAGTA Chr11:114573107..114573126 60.35 50
downstream ENSMUSE00000646313 Chr11:114580443..114582289 TGGTCCCAGAACGTAGATCC Chr11:114580993..114581012 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCTTCTCTGGAATGGATGA Chr11:114557641..114557662 60.06 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGAGATCAGCGTGACTG Chr11:114557704..114557724 60.43 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034714