Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25943
Trapped Gene
Zfp78 (ENSMUSG00000055150)
Vector Insertion
Chr 7: 6325961 - 6328228
Public Clones not available
Private Clones OST149784 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000538211 (Chr7:6325834..6325960 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCGGAACTTGGTCTCTGTG Chr7:6325940..6325959 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000538211 (Chr7:6325834..6325960 +)
Downstram Exon
ENSMUSE00000538208 (Chr7:6328229..6328324 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCGGAACTTGGTCTCTGTG Chr7:6325940..6325959 60.15 55 TTCCTGTCACCTGACCCTTC Chr7:6328315..6328334 60.09 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677214 Chr7:6316043..6316146 CTCGTGGTCCCTGTGTTTTC Chr7:6316118..6316137 60.54 55
upstream ENSMUSE00000677213 Chr7:6323666..6323812 AGGACTGCGTGTTCCAAGAT Chr7:6323711..6323730 59.73 50
upstream ENSMUSE00000677212 Chr7:6324013..6324103 AGAGAAGCCAGGAGGAGGAT Chr7:6324046..6324065 59.4 55
upstream ENSMUSE00000538209 Chr7:6324071..6324103 No primer for this exon
upstream ENSMUSE00000538211 Chr7:6325834..6325960 ACCGGAACTTGGTCTCTGTG Chr7:6325940..6325959 60.15 55

*** Putative Vector Insertion (Chr 7: 6325961 - 6328228) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000538208 Chr7:6328229..6328324 TTCCTGTCACCTGACCCTTC Chr7:6328315..6328334 60.09 55
downstream ENSMUSE00000401183 Chr7:6330919..6332618 AGGACTTTGCGCACTCCTTA Chr7:6331557..6331576 60.01 50
downstream ENSMUSE00000538210 Chr7:6330919..6335315 AGGGATACCCCCTCATGTTC Chr7:6332796..6332815 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAGTCACCTAATCGCCTTGC Chr7:6326003..6326024 59.38 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000055150