Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25961
Trapped Gene
Hexa (ENSMUSG00000025232)
Vector Insertion
Chr 9: 59411795 - 59412627
Public Clones not available
Private Clones OST149129 (lexicon)
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000149105 (Chr9:59411690..59411794 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000149105 (Chr9:59411690..59411794 +)
Downstram Exon
ENSMUSE00000232641 (Chr9:59412628..59412914 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCAAAGGACAGCAACCTCCT Chr9:59412734..59412753 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000232908 Chr9:59387504..59387783 GACGCTACCGTAACCTGCTC Chr9:59387727..59387746 59.9 60
upstream ENSMUSE00000232890 Chr9:59401940..59402032 CAAACGTTGGGGAAGAACAT Chr9:59401948..59401967 59.83 45
upstream ENSMUSE00000232873 Chr9:59403146..59403211 CCAGTGTTTACTCGCCTCTGA Chr9:59403168..59403188 60.44 52.38
upstream ENSMUSE00000232856 Chr9:59404679..59404725 TCAGTCAGCTTGTTTGGAAATC Chr9:59404691..59404712 59.36 40.91
upstream ENSMUSE00000232837 Chr9:59405095..59405205 GGGCGTACTGCTGGATACAT Chr9:59405145..59405164 59.99 55
upstream ENSMUSE00000149101 Chr9:59405841..59405942 TTGGTGGACGACTCTTCCTT Chr9:59405883..59405902 59.7 50
upstream ENSMUSE00000149110 Chr9:59407131..59407263 GACACTCCTGGCCACACTTT Chr9:59407230..59407249 60.16 55
upstream ENSMUSE00000149100 Chr9:59408704..59408884 AGCTCAGTCTTCCCGGACTT Chr9:59408823..59408842 60.39 55
upstream ENSMUSE00000149106 Chr9:59409750..59409833 TCAAGCAGCTGGAGTCCTTC Chr9:59409803..59409822 60.68 55
upstream ENSMUSE00000149107 Chr9:59410103..59410175 TGCTGGACATCGTCTCTGAT Chr9:59410105..59410124 59.37 50
upstream ENSMUSE00000149104 Chr9:59410674..59410857 CTGCTCCCTGGTACCTGAAC Chr9:59410777..59410796 59.72 60
upstream ENSMUSE00000149111 Chr9:59411031..59411121 GAAGGCTCTGGTCATTGGAG Chr9:59411044..59411063 59.8 55
upstream ENSMUSE00000149105 Chr9:59411690..59411794 No primer for this exon

*** Putative Vector Insertion (Chr 9: 59411795 - 59412627) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000232641 Chr9:59412628..59412914 TCAAAGGACAGCAACCTCCT Chr9:59412734..59412753 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTAATCGCCTTGCAGCAC Chr9:59411843..59411863 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCCAAAACTCGTGACTGG Chr9:59411835..59411855 60.83 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025232