Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25962
Trapped Gene
Spc24 (ENSMUSG00000074476)
Vector Insertion
Chr 9: 21561839 - 21562128
Public Clones not available
Private Clones OST149104 (lexicon) OST124347 (lexicon) OST99607 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000638262 (Chr9:21562129..21562273 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACTCTGGCTGTGGAGGAG Chr9:21562254..21562273 59.58 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000638262 (Chr9:21562129..21562273 -)
Downstram Exon
ENSMUSE00000638259 (Chr9:21561734..21561838 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACTCTGGCTGTGGAGGAG Chr9:21562254..21562273 59.58 60 TCCTGCAGCTCTGTGATGAG Chr9:21561793..21561812 60.29 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638264 Chr9:21564563..21564733 GGGAGCTACGAGCAGATGAT Chr9:21564610..21564629 59.42 55
upstream ENSMUSE00000638262 Chr9:21562129..21562273 AGACTCTGGCTGTGGAGGAG Chr9:21562254..21562273 59.58 60

*** Putative Vector Insertion (Chr 9: 21561839 - 21562128) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638259 Chr9:21561734..21561838 TCCTGCAGCTCTGTGATGAG Chr9:21561793..21561812 60.29 55
downstream ENSMUSE00000638257 Chr9:21561561..21561637 CCTGGCTCGCATTCATAATC Chr9:21561553..21561572 60.57 50
downstream ENSMUSE00000702626 Chr9:21560547..21560739 GTGCACTGTCCAAGTGGATG Chr9:21560670..21560689 60.16 55
downstream ENSMUSE00000702627 Chr9:21560547..21560739 GTGCACTGTCCAAGTGGATG Chr9:21560670..21560689 60.16 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGGACCAGCAAGGAGGAC Chr9:21562150..21562170 60.79 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGGACCAGCAAGGAGGAC Chr9:21562150..21562170 60.79 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074476