Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25978
Trapped Gene
Arhgdia (ENSMUSG00000025132)
Vector Insertion
Chr 11: 120441708 - 120442303
Public Clones (sanger) (sanger) (sanger) D016H11 (ggtc) (ggtc) D016H11 (ggtc)
IST14401D5 (tigm)
Private Clones OST148448 (lexicon) OST126979 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668947 (Chr11:120442304..120442694 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATCTGCGGAACTGAAAGG Chr11:120442325..120442344 59.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668947 (Chr11:120442304..120442694 -)
Downstram Exon
ENSMUSE00000384199 (Chr11:120441496..120441707 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATCTGCGGAACTGAAAGG Chr11:120442325..120442344 59.81 50 CTCAGCAGTGGGTTCCTGTT Chr11:120441637..120441656 60.3 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000645555 Chr11:120442836..120442916 GACGACGTTCGTCATTTGGT Chr11:120442872..120442891 60.97 50
upstream ENSMUSE00000668947 Chr11:120442304..120442694 GAATCTGCGGAACTGAAAGG Chr11:120442325..120442344 59.81 50

*** Putative Vector Insertion (Chr 11: 120441708 - 120442303) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000384199 Chr11:120441496..120441707 CTCAGCAGTGGGTTCCTGTT Chr11:120441637..120441656 60.3 55
downstream ENSMUSE00000717989 Chr11:120441496..120441707 CTCAGCAGTGGGTTCCTGTT Chr11:120441637..120441656 60.3 55
downstream ENSMUSE00000148095 Chr11:120441281..120441364 AGTGCTGCATACCAAGGTCA Chr11:120441290..120441309 59.32 50
downstream ENSMUSE00000148094 Chr11:120440982..120441058 ATCCGGTACTCCACACCTTC Chr11:120440976..120440995 58.87 55
downstream ENSMUSE00000148096 Chr11:120440830..120440893 CCGGACACGATCTCTCTGTT Chr11:120440849..120440868 60.26 55
downstream ENSMUSE00000668948 Chr11:120439427..120440744 GAGATTCCACTCCCAGGACA Chr11:120440550..120440569 60.05 55
downstream ENSMUSE00000480495 Chr11:120439423..120440744 GAGATTCCACTCCCAGGACA Chr11:120440550..120440569 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACAGGTAATCGCCTTGCAG Chr11:120442238..120442258 60.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAATCGCCTTGCAGCACATC Chr11:120442624..120442644 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000025132