Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26008
Trapped Gene
Dpy30 (ENSMUSG00000024067)
Vector Insertion
Chr 17: 74715290 - 74715383
Public Clones not available
Private Clones OST146533 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137925 (Chr17:74715384..74715456 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGGTATCCGGTTGATTGC Chr17:74715437..74715456 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137925 (Chr17:74715384..74715456 -)
Downstram Exon
ENSMUSE00000137924 (Chr17:74715242..74715289 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGGTATCCGGTTGATTGC Chr17:74715437..74715456 59.82 50 GCTGTCTGTGAGCCCGTACT Chr17:74715226..74715245 60.48 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692284 Chr17:74715685..74715761 GGGCACTTAGGAACCGACAG Chr17:74715696..74715715 61.96 60
upstream ENSMUSE00000137925 Chr17:74715384..74715456 ACTGGTATCCGGTTGATTGC Chr17:74715437..74715456 59.82 50

*** Putative Vector Insertion (Chr 17: 74715290 - 74715383) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000137924 Chr17:74715242..74715289 GCTGTCTGTGAGCCCGTACT Chr17:74715226..74715245 60.48 60
downstream ENSMUSE00000137928 Chr17:74707060..74707202 TCCACCTTCTGTTTCGATGA Chr17:74707125..74707144 59.22 45
downstream ENSMUSE00000692277 Chr17:74698821..74699164 ATCTTCAAACTGCGCCTTGT Chr17:74699079..74699098 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGGGACAGACACAGGTA Chr17:74715379..74715399 59.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGGGACAGACACAGGTA Chr17:74715379..74715399 59.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024067