Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26010
Trapped Gene
Aasdh (ENSMUSG00000055923)
Vector Insertion
Chr 5: 77325716 - 77330185
Public Clones not available
Private Clones OST146512 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000453936 (Chr5:77330186..77330306 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACTCCCCACCGTCCTTAT Chr5:77330248..77330267 59.82 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000453936 (Chr5:77330186..77330306 -)
Downstram Exon
ENSMUSE00000453930 (Chr5:77325402..77325715 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACTCCCCACCGTCCTTAT Chr5:77330248..77330267 59.82 55 CCATCTTCCCAATGCAGTCT Chr5:77325599..77325618 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716974 Chr5:77334448..77334539 GACGCAGAGGTCCGTTTTAC Chr5:77334506..77334525 59.74 55
upstream ENSMUSE00000712379 Chr5:77333234..77333405 CTGTGGGATCAGCCAGAACT Chr5:77333322..77333341 60.26 55
upstream ENSMUSE00000453949 Chr5:77330943..77331212 GGAATTCGGGAAATTGGTCT Chr5:77330985..77331004 60.13 45
upstream ENSMUSE00000721838 Chr5:77330943..77331210 GGAATTCGGGAAATTGGTCT Chr5:77330985..77331004 60.13 45
upstream ENSMUSE00000453936 Chr5:77330186..77330306 AGACTCCCCACCGTCCTTAT Chr5:77330248..77330267 59.82 55

*** Putative Vector Insertion (Chr 5: 77325716 - 77330185) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000453930 Chr5:77325402..77325715 CCATCTTCCCAATGCAGTCT Chr5:77325599..77325618 60.07 50
downstream ENSMUSE00000453928 Chr5:77320628..77320820 TGGATCGAAGGTCAGAGGAG Chr5:77320735..77320754 60.34 55
downstream ENSMUSE00000453923 Chr5:77317618..77317859 GTATGCGCTGACAGGACAGT Chr5:77317770..77317789 58.91 55
downstream ENSMUSE00000453919 Chr5:77317055..77317161 TGACTTCAATCACCGTTCCA Chr5:77317084..77317103 60.09 45
downstream ENSMUSE00000453913 Chr5:77316213..77316385 AGGGGCACTGTCATTTCATC Chr5:77316315..77316334 59.93 50
downstream ENSMUSE00000453909 Chr5:77315155..77315347 AATGGCAGGGTATCGATCAG Chr5:77315144..77315163 59.92 50
downstream ENSMUSE00000453905 Chr5:77313111..77313226 TCCTCTTTTCCATGGAGTTCA Chr5:77313120..77313140 59.66 42.86
downstream ENSMUSE00000453901 Chr5:77311292..77312087 ACTGGCAGGCAGAGTCCTAA Chr5:77311635..77311654 60.01 55
downstream ENSMUSE00000453895 Chr5:77308935..77309098 TAAAGCATATGCGTGCTGGT Chr5:77308922..77308941 59.35 45
downstream ENSMUSE00000453893 Chr5:77307429..77307551 AAGAGTCCCCCTAGCGTAGC Chr5:77307423..77307442 59.87 60
downstream ENSMUSE00000453889 Chr5:77306552..77306683 CCGATGCAGATGTATTGCTG Chr5:77306576..77306595 60.24 50
downstream ENSMUSE00000476432 Chr5:77304962..77305447 TCTCCGGGGAGTTCATACAC Chr5:77305136..77305155 59.93 55
downstream ENSMUSE00000709757 Chr5:77304960..77305447 TCTCCGGGGAGTTCATACAC Chr5:77305136..77305155 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAACAAATAATCGCCTTGC Chr5:77327122..77327142 60.6 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCTGTATATGCCTCATCCT Chr5:77327161..77327182 60.32 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055923