Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26069
Trapped Gene
Nicn1 (ENSMUSG00000032606)
Vector Insertion
Chr 9: 108196376 - 108196776
Public Clones not available
Private Clones OST140449 (lexicon)
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221503 (Chr9:108196262..108196375 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAACAGAGTGCTGGAGCTG Chr9:108196275..108196294 60.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221503 (Chr9:108196262..108196375 +)
Downstram Exon
ENSMUSE00000221507 (Chr9:108196777..108196848 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAACAGAGTGCTGGAGCTG Chr9:108196275..108196294 60.33 55 CAGGCTGCTCATTGGACACT Chr9:108196837..108196856 61.42 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221508 Chr9:108192779..108192993 TAAGGGACGCCAATAAGAGC Chr9:108192785..108192804 59.32 50
upstream ENSMUSE00000221504 Chr9:108195667..108195843 ACAGCAGCCAAGTGGGTAAC Chr9:108195742..108195761 60.18 55
upstream ENSMUSE00000221503 Chr9:108196262..108196375 TGAACAGAGTGCTGGAGCTG Chr9:108196275..108196294 60.33 55

*** Putative Vector Insertion (Chr 9: 108196376 - 108196776) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221507 Chr9:108196777..108196848 CAGGCTGCTCATTGGACACT Chr9:108196837..108196856 61.42 55
downstream ENSMUSE00000221505 Chr9:108197220..108197324 TCTCTGTCAGTGCCCACATC Chr9:108197283..108197302 59.83 55
downstream ENSMUSE00000392675 Chr9:108197399..108198829 AACTTGGATGCACAGGGAAC Chr9:108197530..108197549 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACAGGGACCAAAGGCAAGT Chr9:108196363..108196383 60.91 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACAGGGACCAAAGGCAAGT Chr9:108196363..108196383 60.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032606