Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26072
Trapped Gene
Zfyve28 (ENSMUSG00000037224)
Vector Insertion
Chr 5: 34578808 - 34585821
Public Clones not available
Private Clones OST140094 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000242641 (Chr5:34585822..34585962 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGAGGTGCACACTGCTTGT Chr5:34585844..34585863 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000242641 (Chr5:34585822..34585962 -)
Downstram Exon
ENSMUSE00000242633 (Chr5:34578652..34578807 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGAGGTGCACACTGCTTGT Chr5:34585844..34585863 60.1 55 AAGTTGTCATGCCGGATCTC Chr5:34578658..34578677 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000242650 Chr5:34630748..34630975 CAGATTCCGAAAGTGGCTGT Chr5:34630759..34630778 60.26 50
upstream ENSMUSE00000699074 Chr5:34630748..34631086 CAGATTCCGAAAGTGGCTGT Chr5:34630759..34630778 60.26 50
upstream ENSMUSE00000699078 Chr5:34630748..34631098 CAGATTCCGAAAGTGGCTGT Chr5:34630759..34630778 60.26 50
upstream ENSMUSE00000716260 Chr5:34630748..34630975 CAGATTCCGAAAGTGGCTGT Chr5:34630759..34630778 60.26 50
upstream ENSMUSE00000242641 Chr5:34585822..34585962 CAGAGGTGCACACTGCTTGT Chr5:34585844..34585863 60.1 55
upstream ENSMUSE00000600726 Chr5:34585822..34586208 CAGAGGTGCACACTGCTTGT Chr5:34585844..34585863 60.1 55

*** Putative Vector Insertion (Chr 5: 34578808 - 34585821) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000242633 Chr5:34578652..34578807 AAGTTGTCATGCCGGATCTC Chr5:34578658..34578677 60.08 50
downstream ENSMUSE00000600725 Chr5:34578652..34578789 AAGTTGTCATGCCGGATCTC Chr5:34578658..34578677 60.08 50
downstream ENSMUSE00000242626 Chr5:34577061..34577136 CTCTCCAGCTCCCGATTCAT Chr5:34577071..34577090 61.67 55
downstream ENSMUSE00000600724 Chr5:34576934..34577136 GTGTTGAGGTCTCGGAGTGC Chr5:34576978..34576997 60.87 60
downstream ENSMUSE00000600723 Chr5:34575954..34576043 GAACAGCACGATGACCTCCT Chr5:34575949..34575968 60.27 55
downstream ENSMUSE00000600722 Chr5:34574803..34574892 CCTGGGTCAGATACCCAAAA Chr5:34574842..34574861 59.78 50
downstream ENSMUSE00000699077 Chr5:34569237..34569540 GGCACAGACAGAAGGGTTTC Chr5:34569306..34569325 59.7 55
downstream ENSMUSE00000600721 Chr5:34567601..34567702 CAGCTCAGACATGTCCTCCA Chr5:34567614..34567633 59.98 55
downstream ENSMUSE00000699082 Chr5:34564618..34565106 TTTGCTTCTTCTGCCAGCTT Chr5:34564676..34564695 60.27 45
downstream ENSMUSE00000600720 Chr5:34559210..34560514 AGCATCCTCTGCACTCACCT Chr5:34559814..34559833 60.02 55
downstream ENSMUSE00000600719 Chr5:34542242..34542393 ACCTGGACCGGATCTTCTCT Chr5:34542268..34542287 60.07 55
downstream ENSMUSE00000242573 Chr5:34541428..34541544 CAGGTCGCTAGCATAGTTCG Chr5:34541482..34541501 58.7 55
downstream ENSMUSE00000242562 Chr5:34540131..34540235 ACTCCGCAGGGTCTGAGTTA Chr5:34540194..34540213 59.87 55
downstream ENSMUSE00000242552 Chr5:34539226..34539329 TGACGGTGAAGGGAGCTTTA Chr5:34539239..34539258 60.77 50
downstream ENSMUSE00000654189 Chr5:34537523..34538749 CAGAGCGTGTGCAATCCTTA Chr5:34537511..34537530 60.01 50
downstream ENSMUSE00000335208 Chr5:34537521..34538749 CAGAGCGTGTGCAATCCTTA Chr5:34537511..34537530 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGCTTGTCAGCCAGTTCC Chr5:34579831..34579851 60.45 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGCTTGTCAGCCAGTTCC Chr5:34579831..34579851 60.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037224