Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26090
Trapped Gene
1700016H13Rik (ENSMUSG00000029320)
Vector Insertion
Chr 5: 104083940 - 104084076
Public Clones not available
Private Clones OST138691 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000317575 (Chr5:104083941..104084075 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAACAGCGGTGCAGATGTTAC Chr5:104084046..104084066 60.19 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000317575 (Chr5:104083941..104084075 -)
Downstram Exon
ENSMUSE00000714000 (Chr5:104083941..104084075 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAACAGCGGTGCAGATGTTAC Chr5:104084046..104084066 60.19 47.62 AACAGCTGCCCTTCAAAATG Chr5:104083926..104083945 60.25 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708418 Chr5:104084789..104085029 CGAAGTGACTCCCATTAGGC Chr5:104084850..104084869 59.69 55
upstream ENSMUSE00000721620 Chr5:104084623..104084767 No primer for this exon
upstream ENSMUSE00000721463 Chr5:104084605..104084742 No primer for this exon
upstream ENSMUSE00000317584 Chr5:104084464..104084743 CTAGCCGGTTCTGTCTGGAA Chr5:104084524..104084543 60.39 55
upstream ENSMUSE00000317575 Chr5:104083941..104084075 AAACAGCGGTGCAGATGTTAC Chr5:104084046..104084066 60.19 47.62
upstream ENSMUSE00000714000 Chr5:104083941..104084075 AAACAGCGGTGCAGATGTTAC Chr5:104084046..104084066 60.19 47.62

*** Putative Vector Insertion (Chr 5: 104083940 - 104084076) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000187951 Chr5:104078441..104078595 CTTTGTGAGTTCCGCAAGGT Chr5:104078540..104078559 60.29 50
downstream ENSMUSE00000711186 Chr5:104077790..104077973 TTTTGTTAGGCGCTTTGCTT Chr5:104077908..104077927 60.02 40
downstream ENSMUSE00000317560 Chr5:104077612..104077973 TTTTGTTAGGCGCTTTGCTT Chr5:104077908..104077927 60.02 40
downstream ENSMUSE00000718701 Chr5:104077058..104077973 TTTTGTTAGGCGCTTTGCTT Chr5:104077908..104077927 60.02 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCAGGCAAAGTGCAAACA Chr5:104084060..104084080 60.42 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAAGGCGTGACTGGGAAAAC Chr5:104084010..104084030 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029320