Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26107
Trapped Gene
Gpr112 (ENSMUSG00000053852)
Vector Insertion
Chr X: 54147429 - 54148045
Public Clones not available
Private Clones OST137230 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700495 (ChrX:54147430..54148044 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGCCTGACCTACACGATG ChrX:54147487..54147506 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700495 (ChrX:54147430..54148044 +)
Downstram Exon
ENSMUSE00000700475 (ChrX:54147549..54148044 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGCCTGACCTACACGATG ChrX:54147487..54147506 59.85 55 CCCTTCACACCATCCCATAC ChrX:54147754..54147773 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700496 ChrX:54125728..54125797 TCAGAGGCTTTGTGGATTGAT ChrX:54125748..54125768 59.69 42.86

*** Putative Vector Insertion (Chr X: 54147429 - 54148045) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000700495 ChrX:54147430..54148044 CCCTTCACACCATCCCATAC ChrX:54147754..54147773 60.05 55
downstream ENSMUSE00000700475 ChrX:54147549..54148044 CCCTTCACACCATCCCATAC ChrX:54147754..54147773 60.05 55
downstream ENSMUSE00000386381 ChrX:54166320..54172214 ACTGGTCTGGGTCCACAAAG ChrX:54171022..54171041 60 55
downstream ENSMUSE00000700494 ChrX:54174602..54174696 GAGGACCCTTGGCTCTTCAT ChrX:54174663..54174682 60.6 55
downstream ENSMUSE00000700493 ChrX:54176332..54176396 No primer for this exon
downstream ENSMUSE00000700492 ChrX:54178341..54178384 CATGGCTGTCTCTTCTTTGGA ChrX:54178370..54178390 60.38 47.62
downstream ENSMUSE00000700491 ChrX:54179578..54179626 ATTGCATCCATTCCTTGACC ChrX:54179611..54179630 59.76 45
downstream ENSMUSE00000700490 ChrX:54181324..54181487 TGATAACCCAACAGGCACAA ChrX:54181346..54181365 59.96 45
downstream ENSMUSE00000700489 ChrX:54183180..54183312 CAAATTCTTGTGGCGTTCCT ChrX:54183315..54183334 60.11 45
downstream ENSMUSE00000700488 ChrX:54185459..54185577 CAGTCTGGATGCTGATGGAA ChrX:54185481..54185500 59.79 50
downstream ENSMUSE00000700487 ChrX:54193845..54194061 ATGTGCTCTGCGACATCATC ChrX:54193875..54193894 59.83 50
downstream ENSMUSE00000700486 ChrX:54195332..54195494 TTGTGACCAACACGCTCAAT ChrX:54195367..54195386 60.16 45
downstream ENSMUSE00000700485 ChrX:54202635..54202769 GTTTGCAAGCCATCAAGAGG ChrX:54202732..54202751 60.78 50
downstream ENSMUSE00000700484 ChrX:54207565..54207684 TGGATCAGCCAAGTTTTGAA ChrX:54207651..54207670 59.25 40
downstream ENSMUSE00000700482 ChrX:54209136..54209181 CAAAATCCCAAAAGGCACAG ChrX:54209175..54209194 60.47 45
downstream ENSMUSE00000700480 ChrX:54210450..54210553 TGGGTGAGGTGGTTACACTG ChrX:54210540..54210559 59.44 55
downstream ENSMUSE00000700479 ChrX:54211935..54212056 GAGGAGATCCCACATCCTGT ChrX:54212017..54212036 58.9 55
downstream ENSMUSE00000700478 ChrX:54213099..54213367 GCATCAGTAACGCTGTGCAT ChrX:54213163..54213182 59.9 50
downstream ENSMUSE00000623875 ChrX:54216583..54216838 AATGGAGTTGTTGGGCTCAG ChrX:54216841..54216860 60.11 50
downstream ENSMUSE00000700477 ChrX:54216760..54216838 AATGGAGTTGTTGGGCTCAG ChrX:54216841..54216860 60.11 50
downstream ENSMUSE00000623874 ChrX:54221297..54221577 AATAAGCCACCACGGAGATG ChrX:54221349..54221368 59.96 50
downstream ENSMUSE00000700476 ChrX:54221297..54221577 AATAAGCCACCACGGAGATG ChrX:54221349..54221368 59.96 50
downstream ENSMUSE00000623873 ChrX:54226558..54226659 CTCCCGAACACTTTCCTTCA ChrX:54226610..54226629 60.22 50
downstream ENSMUSE00000655652 ChrX:54230764..54230907 GTTGTTGACATGAGCGATGG ChrX:54230851..54230870 60.12 50
downstream ENSMUSE00000655651 ChrX:54233257..54233529 TGCAGGCAATGCTCTTCTTA ChrX:54233342..54233361 59.71 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAATAATCGCCTTGCAGCAC ChrX:54147477..54147497 61.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTATGGAGAAGGCAACGTG ChrX:54147463..54147484 60.12 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053852