Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26112
Trapped Gene
Plekha1 (ENSMUSG00000040268)
Vector Insertion
Chr 7: 138044175 - 138045690
Public Clones not available
Private Clones OST136794 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000303403 (Chr7:138044031..138044174 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAACGGTCACAGAGCCATCT Chr7:138044079..138044098 59.73 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000303403 (Chr7:138044031..138044174 +)
Downstram Exon
ENSMUSE00000303397 (Chr7:138045691..138045759 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAACGGTCACAGAGCCATCT Chr7:138044079..138044098 59.73 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000722344 Chr7:138009270..138009497 TAGTGTTCGCGGTAGGGAGT Chr7:138009320..138009339 59.76 55
upstream ENSMUSE00000587719 Chr7:138009412..138009514 No primer for this exon
upstream ENSMUSE00000303424 Chr7:138009424..138009497 No primer for this exon
upstream ENSMUSE00000303418 Chr7:138021248..138021408 GACAGAATCGCATCTGTGGA Chr7:138021284..138021303 59.79 50
upstream ENSMUSE00000710017 Chr7:138021248..138021408 GACAGAATCGCATCTGTGGA Chr7:138021284..138021303 59.79 50
upstream ENSMUSE00000303415 Chr7:138025844..138025900 ACGGGTTGGAGCCATTAAAC Chr7:138025864..138025883 61.1 50
upstream ENSMUSE00000433230 Chr7:138028917..138028962 GCCAAAGGCAGAGTTTTGTT Chr7:138028940..138028959 59.36 45
upstream ENSMUSE00000433218 Chr7:138035695..138035792 TGATCAGCAGGACTTAGTGGAG Chr7:138035735..138035756 59.5 50
upstream ENSMUSE00000303411 Chr7:138040839..138040964 TGACATTGTTGGTGGTGTGC Chr7:138040925..138040944 61.5 50
upstream ENSMUSE00000303403 Chr7:138044031..138044174 AAACGGTCACAGAGCCATCT Chr7:138044079..138044098 59.73 50

*** Putative Vector Insertion (Chr 7: 138044175 - 138045690) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000303397 Chr7:138045691..138045759 No primer for this exon
downstream ENSMUSE00000303392 Chr7:138048384..138048448 AAGTGGTATCACCCGCAGAG Chr7:138048416..138048435 60.13 55
downstream ENSMUSE00000526658 Chr7:138048905..138048968 TCGTCACGATTTCAAACAGG Chr7:138048948..138048967 59.69 45
downstream ENSMUSE00000303374 Chr7:138051850..138051939 GCGCCAGAGACTGCTTTAAT Chr7:138051902..138051921 59.62 50
downstream ENSMUSE00000511504 Chr7:138053102..138053142 AAGGGTTCGACAGCCTTCTG Chr7:138053135..138053154 61.71 55
downstream ENSMUSE00000717258 Chr7:138053102..138053249 GCTGTAAGGAGGAGCGAGTC Chr7:138053240..138053259 59.19 60
downstream ENSMUSE00000512089 Chr7:138054346..138056816 GTGCTGGGCAACTAAAGAGC Chr7:138056162..138056181 60.02 55
downstream ENSMUSE00000526656 Chr7:138054346..138054997 AGGACGGACAGTGAATTTGG Chr7:138054393..138054412 59.97 50
downstream ENSMUSE00000668952 Chr7:138054346..138054997 AGGACGGACAGTGAATTTGG Chr7:138054393..138054412 59.97 50
downstream ENSMUSE00000714336 Chr7:138054346..138056826 GTGCTGGGCAACTAAAGAGC Chr7:138056162..138056181 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGGAGCGGTGGTGAGTAG Chr7:138044164..138044184 60.84 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGGAGCGGTGGTGAGTAG Chr7:138044164..138044184 60.84 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040268