Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26126
Trapped Gene
Arhgap26 (ENSMUSG00000036452)
Vector Insertion
Chr 18: 39153284 - 39257283
Public Clones (ggtc) (ggtc) (cmhd) IST14619B2 (tigm)
Private Clones OST135790 (lexicon) OST33122 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714908 (Chr18:39152799..39153283 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGACGCTCAAGTCACACGA Chr18:39153187..39153206 60.19 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714908 (Chr18:39152799..39153283 +)
Downstram Exon
ENSMUSE00000659535 (Chr18:39257284..39257379 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGACGCTCAAGTCACACGA Chr18:39153187..39153206 60.19 55 TCATCATCTGTTTCGGCATC Chr18:39257371..39257390 59.61 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000659536 Chr18:39152799..39153283 GAGACGCTCAAGTCACACGA Chr18:39153187..39153206 60.19 55
upstream ENSMUSE00000714908 Chr18:39152799..39153283 GAGACGCTCAAGTCACACGA Chr18:39153187..39153206 60.19 55

*** Putative Vector Insertion (Chr 18: 39153284 - 39257283) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000659535 Chr18:39257284..39257379 TCATCATCTGTTTCGGCATC Chr18:39257371..39257390 59.61 45
downstream ENSMUSE00000493448 Chr18:39259226..39259803 CCTTTCTTCGGCATTAGCAG Chr18:39259695..39259714 59.97 50
downstream ENSMUSE00000659534 Chr18:39259226..39259287 CTCCGCTCGTCTTCAAGATT Chr18:39259283..39259302 59.57 50
downstream ENSMUSE00000659533 Chr18:39261823..39261894 CGAAACTTCTCCAAGGGTGT Chr18:39261872..39261891 59.18 50
downstream ENSMUSE00000659532 Chr18:39270109..39270210 CCGCAGTACTTCTCGGTCTC Chr18:39270155..39270174 60.01 60
downstream ENSMUSE00000659531 Chr18:39271444..39271554 CGTAGAAATGTTGCCGAACC Chr18:39271486..39271505 60.5 50
downstream ENSMUSE00000659530 Chr18:39279773..39279877 AATCCTTGGCCAGCTCATAA Chr18:39279839..39279858 59.67 45
downstream ENSMUSE00000659529 Chr18:39281428..39281557 GTGTACGGGCTGATGGTCTT Chr18:39281528..39281547 60 55
downstream ENSMUSE00000659528 Chr18:39286487..39286587 TGGAATCCCGTTGGTAGGTA Chr18:39286543..39286562 60.18 50
downstream ENSMUSE00000659527 Chr18:39291710..39291804 TGAGGGTAACGGACTCGTCT Chr18:39291737..39291756 59.72 55
downstream ENSMUSE00000659526 Chr18:39309694..39309772 TACGGTCCTCTTCCGACAAC Chr18:39309740..39309759 60.11 55
downstream ENSMUSE00000659525 Chr18:39364938..39364974 TCTGGCTGTCTCTGTTGGAG Chr18:39364968..39364987 59.12 55
downstream ENSMUSE00000267794 Chr18:39387020..39387087 CTGAAGCCGATACTGTCCAA Chr18:39387052..39387071 58.87 50
downstream ENSMUSE00000659524 Chr18:39387022..39387087 CTGAAGCCGATACTGTCCAA Chr18:39387052..39387071 58.87 50
downstream ENSMUSE00000659517 Chr18:39389545..39389619 ATCAGGACGCTCAGCAACTT Chr18:39389620..39389639 60.02 50
downstream ENSMUSE00000659523 Chr18:39389545..39389619 ATCAGGACGCTCAGCAACTT Chr18:39389620..39389639 60.02 50
downstream ENSMUSE00000659516 Chr18:39403260..39403347 GAGCACTGGTGACGGTCTTT Chr18:39403334..39403353 60.31 55
downstream ENSMUSE00000659522 Chr18:39403260..39403347 GAGCACTGGTGACGGTCTTT Chr18:39403334..39403353 60.31 55
downstream ENSMUSE00000659515 Chr18:39404937..39404995 GGTACATCATGAGGGGTCCT Chr18:39404968..39404987 58.67 55
downstream ENSMUSE00000659521 Chr18:39404937..39404995 GGTACATCATGAGGGGTCCT Chr18:39404968..39404987 58.67 55
downstream ENSMUSE00000659514 Chr18:39406473..39406578 GAGCCGATGGACAAGACTGT Chr18:39406531..39406550 60.27 55
downstream ENSMUSE00000659520 Chr18:39406473..39406578 GAGCCGATGGACAAGACTGT Chr18:39406531..39406550 60.27 55
downstream ENSMUSE00000659513 Chr18:39446181..39446340 CAGGTTTGCCACAGTCATCA Chr18:39446229..39446248 60.72 50
downstream ENSMUSE00000659519 Chr18:39446181..39446340 CAGGTTTGCCACAGTCATCA Chr18:39446229..39446248 60.72 50
downstream ENSMUSE00000267685 Chr18:39456439..39456577 TTCTTCCGGGACAGGTGTAG Chr18:39456503..39456522 60.1 55
downstream ENSMUSE00000355575 Chr18:39466356..39466506 TGATGATGCTGTTCCTCTGC Chr18:39466382..39466401 59.95 50
downstream ENSMUSE00000465334 Chr18:39517207..39517482 AAAGTTGACGAGGAGGCTGA Chr18:39517417..39517436 59.99 50
downstream ENSMUSE00000467724 Chr18:39517207..39517317 GTGAAGTTGGGCTTGGATTC Chr18:39517235..39517254 59.53 50
downstream ENSMUSE00000395202 Chr18:39517453..39517482 AGTCTTCACGGACCGCTTCT Chr18:39517481..39517500 61.36 55
downstream ENSMUSE00000341650 Chr18:39522239..39522508 CTCGCAGATATGACGACCAA Chr18:39522433..39522452 59.82 50
downstream ENSMUSE00000423778 Chr18:39522771..39522862 TGTGAAGGAGAGCTCCGAGT Chr18:39522843..39522862 60.13 55
downstream ENSMUSE00000423781 Chr18:39522771..39522862 TGTGAAGGAGAGCTCCGAGT Chr18:39522843..39522862 60.13 55
downstream ENSMUSE00000468946 Chr18:39530728..39532165 GAGAGAAAGAGCGCCTGCTA Chr18:39531288..39531307 60 55
downstream ENSMUSE00000572654 Chr18:39530728..39532165 GAGAGAAAGAGCGCCTGCTA Chr18:39531288..39531307 60 55
downstream ENSMUSE00000659518 Chr18:39530728..39535939 GAGAGAAAGAGCGCCTGCTA Chr18:39531288..39531307 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGGGCATTGAAGGTAATC Chr18:39222320..39222340 59.53 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGCGTGACTGGGAAAAC Chr18:39222330..39222350 61.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036452