Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2615
Trapped Gene
Ell (ENSMUSG00000070002)
Vector Insertion
Chr 8: 73096810 - 73102735
Public Clones XR0772 (sanger) IST12559B11BBF1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000581994 (Chr8:73096762..73096809 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACCTTCCATCCGATTTGA Chr8:73096777..73096796 59.48 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000581994 (Chr8:73096762..73096809 +)
Downstram Exon
ENSMUSE00000581993 (Chr8:73102736..73102857 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACCTTCCATCCGATTTGA Chr8:73096777..73096796 59.48 45 GTTGGATGCAATCAAAGCTG Chr8:73102847..73102866 59.28 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581995 Chr8:73063604..73063740 CTCACCGACAGTGCTTTGAA Chr8:73063693..73063712 60.03 50
upstream ENSMUSE00000581994 Chr8:73096762..73096809 AGACCTTCCATCCGATTTGA Chr8:73096777..73096796 59.48 45

*** Putative Vector Insertion (Chr 8: 73096810 - 73102735) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000581993 Chr8:73102736..73102857 GTTGGATGCAATCAAAGCTG Chr8:73102847..73102866 59.28 45
downstream ENSMUSE00000581992 Chr8:73102992..73103155 CAGTAGCACACACCGTGACC Chr8:73103059..73103078 60.23 60
downstream ENSMUSE00000581991 Chr8:73105454..73105719 AGGGCCTCTGTACCACACTG Chr8:73105597..73105616 60.17 60
downstream ENSMUSE00000581990 Chr8:73107771..73107895 GCAGGCTTTTGTACATGCAG Chr8:73107837..73107856 59.49 50
downstream ENSMUSE00000581989 Chr8:73109056..73109134 No primer for this exon
downstream ENSMUSE00000581988 Chr8:73109453..73109927 GTGCTCGCTGTGTGAAATGT Chr8:73109528..73109547 59.91 50
downstream ENSMUSE00000581987 Chr8:73114419..73114479 GTTCATTGTCACAGGCTCCA Chr8:73114448..73114467 59.68 50
downstream ENSMUSE00000581986 Chr8:73114593..73114764 TTGTAGCTCTGACGCTGCTC Chr8:73114640..73114659 59.49 55
downstream ENSMUSE00000581985 Chr8:73115269..73115313 No primer for this exon
downstream ENSMUSE00000581983 Chr8:73115397..73116755 CCTCTAGGGTCTGGGGACTC Chr8:73116276..73116295 60.07 65

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGACCTTCCATCCGATTTG Chr8:73096777..73096797 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGACCTTCCATCCGATTT Chr8:73096776..73096796 59.48 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070002