Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26151
Trapped Gene
Syn1 (ENSMUSG00000037217)
Vector Insertion
Chr X: 20442388 - 20442971
Public Clones not available
Private Clones OST134184 (lexicon)
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000324360 (ChrX:20442972..20443034 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCACAACATACCCTGTGG ChrX:20443010..20443029 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000324360 (ChrX:20442972..20443034 -)
Downstram Exon
ENSMUSE00000624561 (ChrX:20442245..20442387 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCACAACATACCCTGTGG ChrX:20443010..20443029 60.03 55 GTTCTGCCCAATCTTCTGGA ChrX:20442237..20442256 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000468803 ChrX:20497539..20498022 GCTTCTTCTCGTCGCTGTCT ChrX:20497673..20497692 59.9 55
upstream ENSMUSE00000702543 ChrX:20497539..20498130 GCTTCTTCTCGTCGCTGTCT ChrX:20497673..20497692 59.9 55
upstream ENSMUSE00000324391 ChrX:20486651..20486708 GGGAAGAAGATCCATGGAGAA ChrX:20486672..20486692 60.4 47.62
upstream ENSMUSE00000324386 ChrX:20486463..20486554 TGGAAGTTCTTCGGAATGGA ChrX:20486477..20486496 60.57 45
upstream ENSMUSE00000624562 ChrX:20485077..20485233 CTTCAGCATGGCACGTAATG ChrX:20485175..20485194 60.28 50
upstream ENSMUSE00000378197 ChrX:20484203..20484292 GCCCAGATGGTTCGACTACA ChrX:20484270..20484289 61.07 55
upstream ENSMUSE00000324360 ChrX:20442972..20443034 CAGCACAACATACCCTGTGG ChrX:20443010..20443029 60.03 55

*** Putative Vector Insertion (Chr X: 20442388 - 20442971) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000624561 ChrX:20442245..20442387 GTTCTGCCCAATCTTCTGGA ChrX:20442237..20442256 60.19 50
downstream ENSMUSE00000324341 ChrX:20442081..20442155 GGTCTTCCAGTTACCCGACA ChrX:20442103..20442122 59.97 55
downstream ENSMUSE00000324329 ChrX:20441887..20441989 GATGTCAAGTCCCCCAAAAA ChrX:20441916..20441935 59.77 45
downstream ENSMUSE00000324320 ChrX:20440710..20440856 AGTTCCACGATGAGCTGCTT ChrX:20440767..20440786 60.02 50
downstream ENSMUSE00000324312 ChrX:20440309..20440396 No primer for this exon
downstream ENSMUSE00000495548 ChrX:20439899..20440216 AAAGATGTTGCTGGCCTTGT ChrX:20440108..20440127 59.74 45
downstream ENSMUSE00000556820 ChrX:20439625..20439814 No primer for this exon
downstream ENSMUSE00000624560 ChrX:20439625..20440216 AAAGATGTTGCTGGCCTTGT ChrX:20440108..20440127 59.74 45
downstream ENSMUSE00000702557 ChrX:20437641..20438735 GGGCTGTCTAGGGGTTTAGG ChrX:20438540..20438559 59.96 60
downstream ENSMUSE00000702539 ChrX:20437637..20438697 GGGCTGTCTAGGGGTTTAGG ChrX:20438540..20438559 59.96 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTGTGGTTGTGAAGATGG ChrX:20442996..20443016 61.37 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037217