Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26160
Trapped Gene
Exoc3 (ENSMUSG00000034152)
Vector Insertion
Chr 13: 74344546 - 74346105
Public Clones not available
Private Clones OST133582 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000340462 (Chr13:74346106..74346139 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000340462 (Chr13:74346106..74346139 -)
Downstram Exon
ENSMUSE00000338780 (Chr13:74344355..74344545 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTTCCCTTCTGCGATACTGC Chr13:74344368..74344387 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000340462 Chr13:74346106..74346139 No primer for this exon

*** Putative Vector Insertion (Chr 13: 74344546 - 74346105) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000338780 Chr13:74344355..74344545 CTTCCCTTCTGCGATACTGC Chr13:74344368..74344387 59.98 55
downstream ENSMUSE00000222968 Chr13:74336904..74337123 TCCTTGACGTCATTCAGTGC Chr13:74337025..74337044 59.84 50
downstream ENSMUSE00000222962 Chr13:74330056..74330737 CCCCTGTGTGCTACCAAAGT Chr13:74330534..74330553 60.03 55
downstream ENSMUSE00000222957 Chr13:74327518..74327635 CCAGGGCACTAACATCCACT Chr13:74327558..74327577 59.99 55
downstream ENSMUSE00000222951 Chr13:74326609..74326734 GTTTCCAGTGCTTTCCGAAG Chr13:74326675..74326694 59.85 50
downstream ENSMUSE00000222946 Chr13:74322121..74322221 No primer for this exon
downstream ENSMUSE00000381900 Chr13:74319725..74319835 TGCACATAACAGTGTGGGTGT Chr13:74319742..74319762 59.94 47.62
downstream ENSMUSE00000346608 Chr13:74319492..74319642 CTTCCTTAGCAATGGCGTCT Chr13:74319511..74319530 59.48 50
downstream ENSMUSE00000384118 Chr13:74317883..74318005 GATGATGTCCACAGCGTTTG Chr13:74317921..74317940 60.12 50
downstream ENSMUSE00000391436 Chr13:74311435..74311596 CTCTTCAGCACTCCGAAAGG Chr13:74311485..74311504 60.13 55
downstream ENSMUSE00000222924 Chr13:74310744..74310871 CACAGTGTCCATCTGCATCC Chr13:74310819..74310838 60.12 55
downstream ENSMUSE00000379311 Chr13:74309441..74309692 AGCTTTGCCACGTTCAGACT Chr13:74309509..74309528 60.06 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr13:74346035..74346055 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGAAGCTCTGCTCTGACA Chr13:74346082..74346102 58.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034152