Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26177
Trapped Gene
Smc1b (ENSMUSG00000022432)
Vector Insertion
Chr 15: 84928464 - 84937347
Public Clones not available
Private Clones OST132410 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000126507 (Chr15:84937348..84937494 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGCTCTGTGCTGGGATGA Chr15:84937403..84937422 60.94 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000126507 (Chr15:84937348..84937494 -)
Downstram Exon
ENSMUSE00000126492 (Chr15:84928326..84928463 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGCTCTGTGCTGGGATGA Chr15:84937403..84937422 60.94 50 ATCTGTTTCCTTGCGGAGTG Chr15:84928409..84928428 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000126496 Chr15:84962259..84962387 CTGCTGCTCGTGGAGAATTT Chr15:84962333..84962352 60.54 50
upstream ENSMUSE00000126482 Chr15:84960101..84960289 TGGAGCACATACTGGAAAACC Chr15:84960181..84960201 59.99 47.62
upstream ENSMUSE00000126495 Chr15:84958189..84958301 CCCGTGAGTCGTTCTGTGTA Chr15:84958250..84958269 59.74 55
upstream ENSMUSE00000126491 Chr15:84957898..84958101 AGAACGGAAGCATGCAAAAA Chr15:84957912..84957931 60.75 40
upstream ENSMUSE00000126502 Chr15:84954151..84954389 TAGAGCAAATGGACGGGAAT Chr15:84954261..84954280 59.53 45
upstream ENSMUSE00000126486 Chr15:84952019..84952277 GGGCGAGATATTGAATTGGA Chr15:84952029..84952048 59.86 45
upstream ENSMUSE00000126517 Chr15:84951048..84951188 TTTGAAAAGAGGAGGCATGG Chr15:84951058..84951077 60.18 45
upstream ENSMUSE00000126500 Chr15:84946269..84946351 No primer for this exon
upstream ENSMUSE00000126518 Chr15:84945109..84945316 ATGAGGGAAAACGTCAGCAG Chr15:84945160..84945179 60.26 50
upstream ENSMUSE00000126513 Chr15:84943117..84943302 TAAGCTTTTTGGCCGGTACA Chr15:84943224..84943243 60.61 45
upstream ENSMUSE00000126493 Chr15:84941082..84941261 TCAAGCCAATCAATGAACGA Chr15:84941241..84941260 60.2 40
upstream ENSMUSE00000126507 Chr15:84937348..84937494 AAAGCTCTGTGCTGGGATGA Chr15:84937403..84937422 60.94 50

*** Putative Vector Insertion (Chr 15: 84928464 - 84937347) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000126492 Chr15:84928326..84928463 ATCTGTTTCCTTGCGGAGTG Chr15:84928409..84928428 60.26 50
downstream ENSMUSE00000126504 Chr15:84927935..84928051 TGCTGTTTGTTGATTCCTTCA Chr15:84927950..84927970 59.31 38.1
downstream ENSMUSE00000126498 Chr15:84927076..84927182 CACGGATATTTTCCACACCA Chr15:84927103..84927122 59.25 45
downstream ENSMUSE00000126497 Chr15:84922373..84922514 CTTTGCCCTTCTGGATTGTG Chr15:84922374..84922393 60.63 50
downstream ENSMUSE00000126511 Chr15:84921302..84921447 CCTTCTTGCGTTCCTCTTCA Chr15:84921296..84921315 60.51 50
downstream ENSMUSE00000126506 Chr15:84920022..84920175 AATGACCCCAGCACAAGACT Chr15:84920022..84920041 59.58 50
downstream ENSMUSE00000126515 Chr15:84916523..84916618 TCCTCCCTTAGAGGGCTGTAG Chr15:84916508..84916528 59.85 57.14
downstream ENSMUSE00000315616 Chr15:84902012..84902168 GTTCTCCTGTGCTCGCAAGT Chr15:84902030..84902049 60.6 55
downstream ENSMUSE00000126489 Chr15:84901210..84901364 CGTACCTCCGTCTTTTCACC Chr15:84901271..84901290 59.59 55
downstream ENSMUSE00000126484 Chr15:84900075..84900226 CCTGGAGCCACACAGTTGTA Chr15:84900134..84900153 59.74 55
downstream ENSMUSE00000126480 Chr15:84898167..84898236 TCCAGGGCTGCATCTACTTC Chr15:84898164..84898183 60.36 55
downstream ENSMUSE00000126490 Chr15:84896649..84896759 GGGTAGACGCCTATCAGTGC Chr15:84896631..84896650 59.72 60
downstream ENSMUSE00000404968 Chr15:84895121..84895535 CTCCACAGGGTCAGGGTAAA Chr15:84895311..84895330 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr15:84931277..84931297 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATGCACGTGACTGGGAAAA Chr15:84934282..84934302 60.11 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022432