Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2618
Trapped Gene
Ap3s2 (ENSMUSG00000063801)
Vector Insertion
Chr 7: 87027460 - 87054720
Public Clones AE0788 (sanger) XR0706 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000317686 (Chr7:87054721..87054792 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGTTGGACTTGATCTTCCA Chr7:87054731..87054751 58.27 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000317686 (Chr7:87054721..87054792 -)
Downstram Exon
ENSMUSE00000317677 (Chr7:87027352..87027459 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGTTGGACTTGATCTTCCA Chr7:87054731..87054751 58.27 42.86 TCGGTTTTGAGCTTCGATTT Chr7:87027345..87027364 59.82 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000317706 Chr7:87065395..87065487 ATGATTCAGGCGATTCTGGT Chr7:87065444..87065463 59.51 45
upstream ENSMUSE00000200298 Chr7:87060902..87060993 CCTCAAGCGAGATGACAACA Chr7:87060927..87060946 59.98 50
upstream ENSMUSE00000200301 Chr7:87060033..87060144 TTGGGATCTTGGACCTCATC Chr7:87060036..87060055 59.86 50
upstream ENSMUSE00000317686 Chr7:87054721..87054792 TGAGTTGGACTTGATCTTCCA Chr7:87054731..87054751 58.27 42.86

*** Putative Vector Insertion (Chr 7: 87027460 - 87054720) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000317677 Chr7:87027352..87027459 TCGGTTTTGAGCTTCGATTT Chr7:87027345..87027364 59.82 40
downstream ENSMUSE00000317668 Chr7:87020218..87025498 AGGTGAAGAACACCCCACAG Chr7:87021443..87021462 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGACTGCTGCTGCCAACTT Chr7:87036715..87036735 58.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGACTGCTGCTGCCAACTT Chr7:87036715..87036735 58.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063801