Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26185
Trapped Gene
Siah1b (ENSMUSG00000040749)
Vector Insertion
Chr X: 160513602 - 160513946
Public Clones not available
Private Clones OST132082 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000238260 (ChrX:160513947..160513981 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCCTTTACACGCACTGTCT ChrX:160513951..160513970 60.32 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000238260 (ChrX:160513947..160513981 -)
Downstram Exon
ENSMUSE00000238253 (ChrX:160513510..160513601 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCCTTTACACGCACTGTCT ChrX:160513951..160513970 60.32 55 CAGTAGCCAGCCCTTAATGC ChrX:160513509..160513528 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000439238 ChrX:160514047..160514082 No primer for this exon
upstream ENSMUSE00000238260 ChrX:160513947..160513981 GGCCTTTACACGCACTGTCT ChrX:160513951..160513970 60.32 55

*** Putative Vector Insertion (Chr X: 160513602 - 160513946) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000238253 ChrX:160513510..160513601 CAGTAGCCAGCCCTTAATGC ChrX:160513509..160513528 59.87 55
downstream ENSMUSE00000238244 ChrX:160511222..160511282 AAGGTTCCACATTCTTGGTCA ChrX:160511208..160511228 59.44 42.86
downstream ENSMUSE00000462557 ChrX:160508637..160510159 TTCAGCTTGTTTGCGTGTTC ChrX:160509336..160509355 60.03 45
downstream ENSMUSE00000478735 ChrX:160508635..160510159 TTCAGCTTGTTTGCGTGTTC ChrX:160509336..160509355 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTGGGGACAAGGACTACC ChrX:160513974..160513994 59.42 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTGGGGACAAGGACTACC ChrX:160513974..160513994 59.42 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040749