Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26186
Trapped Gene
Sc4mol (ENSMUSG00000031604)
Vector Insertion
Chr 8: 67206706 - 67212304
Public Clones (ggtc) (ggtc)
Private Clones OST132010 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000211092 (Chr8:67212305..67212375 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTAGACCGCTGTCTGTCG Chr8:67212317..67212336 61.14 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000211092 (Chr8:67212305..67212375 -)
Downstram Exon
ENSMUSE00000211090 (Chr8:67206421..67206705 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTAGACCGCTGTCTGTCG Chr8:67212317..67212336 61.14 60 TCTCTGCGAGGGACCTTTTA Chr8:67206661..67206680 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000211092 Chr8:67212305..67212375 GCTTAGACCGCTGTCTGTCG Chr8:67212317..67212336 61.14 60

*** Putative Vector Insertion (Chr 8: 67206706 - 67212304) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211090 Chr8:67206421..67206705 TCTCTGCGAGGGACCTTTTA Chr8:67206661..67206680 59.95 50
downstream ENSMUSE00000211094 Chr8:67202385..67202533 TGGCATTCTTTCCCAATCAT Chr8:67202368..67202387 60.27 40
downstream ENSMUSE00000211091 Chr8:67201261..67201387 GCCAGGTGTCCTCAATGACT Chr8:67201313..67201332 60.12 55
downstream ENSMUSE00000211093 Chr8:67199139..67199293 CCAAGGGATGTGCGTATTCT Chr8:67199232..67199251 59.96 50
downstream ENSMUSE00000211095 Chr8:67196942..67197978 CCAGAAGGATCGGACAAAAA Chr8:67196992..67197011 60.04 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGCGCTCTCTAGCCTGAT Chr8:67209281..67209301 60.64 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGCGCTCTCTAGCCTGAT Chr8:67209281..67209301 60.64 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGTAATCGCCTTGCAGCAC Chr8:67206401..67206421 62.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCGGCAGAGGTAGTGAGGAG Chr8:67206359..67206379 62.28 65 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031604