Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26191
Trapped Gene
RP23-117O11.3 (ENSMUSG00000035399)
Vector Insertion
Chr 2: 163241392 - 163245147
Public Clones IST14662C4 (tigm) IST14593D5 (tigm)
Private Clones OST131669 (lexicon) OST32372 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000407125 (Chr2:163245148..163245206 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000407125 (Chr2:163245148..163245206 -)
Downstram Exon
ENSMUSE00000329327 (Chr2:163241271..163241391 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTGGCTTCGGATTTCATTGT Chr2:163241309..163241328 60.45 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000407125 Chr2:163245148..163245206 No primer for this exon

*** Putative Vector Insertion (Chr 2: 163241392 - 163245147) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000329327 Chr2:163241271..163241391 TTGGCTTCGGATTTCATTGT Chr2:163241309..163241328 60.45 40
downstream ENSMUSE00000329324 Chr2:163237133..163237246 TATCATCGGCTGCTGTTCTG Chr2:163237154..163237173 59.97 50
downstream ENSMUSE00000365176 Chr2:163231561..163232825 TCTTGCTGCCACATCGTAAG Chr2:163231789..163231808 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:163242077..163242097 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCAGGGAGCTTTTCTCAC Chr2:163245104..163245124 60.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr2:163242137..163242157 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTTGGATCCGGGTCAGACAG Chr2:163245217..163245237 63.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035399