Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26194
Trapped Gene
Acot8 (ENSMUSG00000017307)
Vector Insertion
Chr 2: 164621310 - 164625219
Public Clones not available
Private Clones OST131428 (lexicon)
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000242893 (Chr2:164625220..164625445 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000242893 (Chr2:164625220..164625445 -)
Downstram Exon
ENSMUSE00000171740 (Chr2:164621152..164621309 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355558 Chr2:164630190..164630382 No primer for this exon
upstream ENSMUSE00000661247 Chr2:164630190..164630380 No primer for this exon
upstream ENSMUSE00000171745 Chr2:164628497..164628633 No primer for this exon
upstream ENSMUSE00000242893 Chr2:164625220..164625445 No primer for this exon

*** Putative Vector Insertion (Chr 2: 164621310 - 164625219) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171740 Chr2:164621152..164621309 No primer for this exon
downstream ENSMUSE00000242872 Chr2:164620582..164620679 No primer for this exon
downstream ENSMUSE00000661246 Chr2:164620485..164620679 No primer for this exon
downstream ENSMUSE00000490722 Chr2:164618269..164618510 No primer for this exon
downstream ENSMUSE00000661245 Chr2:164618268..164618510 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGACCTGCTGGATCACGAG Chr2:164625241..164625261 60.41 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTAGGGGTGTGTCGTGACT Chr2:164625161..164625181 59.02 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017307