Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26201
Trapped Gene
Atxn7l1 (ENSMUSG00000020564)
Vector Insertion
Chr 12: 34043520 - 34043714
Public Clones not available
Private Clones OST130905 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000655319 (Chr12:34043521..34043713 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000655319 (Chr12:34043521..34043713 +)
Downstram Exon
ENSMUSE00000655315 (Chr12:34043521..34043713 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000655329 Chr12:33987416..33987493 No primer for this exon
upstream ENSMUSE00000709389 Chr12:34010776..34010998 No primer for this exon
upstream ENSMUSE00000715174 Chr12:34010776..34010998 No primer for this exon
upstream ENSMUSE00000655323 Chr12:34026786..34027060 No primer for this exon
upstream ENSMUSE00000685559 Chr12:34026786..34027060 No primer for this exon
upstream ENSMUSE00000655322 Chr12:34029755..34029837 No primer for this exon
upstream ENSMUSE00000685558 Chr12:34029755..34029837 No primer for this exon
upstream ENSMUSE00000655320 Chr12:34030703..34030953 No primer for this exon
upstream ENSMUSE00000685557 Chr12:34030703..34030953 No primer for this exon

*** Putative Vector Insertion (Chr 12: 34043520 - 34043714) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000655315 Chr12:34043521..34043713 No primer for this exon
downstream ENSMUSE00000655319 Chr12:34043521..34043713 No primer for this exon
downstream ENSMUSE00000106619 Chr12:34047838..34047959 No primer for this exon
downstream ENSMUSE00000615133 Chr12:34049250..34049555 No primer for this exon
downstream ENSMUSE00000504457 Chr12:34051837..34053138 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCACAGCTAATCGCCTTG Chr12:34043562..34043582 60.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGTCTCACCCTTAGACCAT Chr12:34043507..34043527 59.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020564