Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI26227
Trapped Gene
Prkar2a (ENSMUSG00000032601)
Vector Insertion
Chr 9: 108630612 - 108635440
Public Clones not available
Private Clones OST129662 (lexicon)
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634245 (Chr9:108630505..108630611 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGACGGGGACAACTTTTA Chr9:108630580..108630599 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634245 (Chr9:108630505..108630611 +)
Downstram Exon
ENSMUSE00000239556 (Chr9:108635441..108635594 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGACGGGGACAACTTTTA Chr9:108630580..108630599 59.97 50 CTGCCACGGTTGTCATACTG Chr9:108635515..108635534 60.17 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634246 Chr9:108594474..108595043 AGTGACTCGGACTCGGAAGA Chr9:108595010..108595029 59.99 55
upstream ENSMUSE00000404418 Chr9:108595368..108595516 GCTTTCCGAAGACAAGAGCA Chr9:108595384..108595403 60.66 50
upstream ENSMUSE00000239601 Chr9:108616604..108616639 No primer for this exon
upstream ENSMUSE00000239582 Chr9:108619194..108619246 No primer for this exon
upstream ENSMUSE00000439254 Chr9:108621534..108621617 CATCCCAAAACTGATGAGCA Chr9:108621540..108621559 59.65 45
upstream ENSMUSE00000634245 Chr9:108630505..108630611 GACGACGGGGACAACTTTTA Chr9:108630580..108630599 59.97 50

*** Putative Vector Insertion (Chr 9: 108630612 - 108635440) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000239556 Chr9:108635441..108635594 CTGCCACGGTTGTCATACTG Chr9:108635515..108635534 60.17 55
downstream ENSMUSE00000221338 Chr9:108642766..108642867 No primer for this exon
downstream ENSMUSE00000221337 Chr9:108643019..108643093 AGATCTTTTCCCCGATCACA Chr9:108643067..108643086 59.48 45
downstream ENSMUSE00000221339 Chr9:108646561..108646626 TAGAAGCTGTCGGCCTTTTC Chr9:108646586..108646605 59.59 50
downstream ENSMUSE00000221335 Chr9:108647813..108647954 CTTATGGCAATGGGCAATCT Chr9:108647872..108647891 59.92 45
downstream ENSMUSE00000495082 Chr9:108649192..108651843 AGGTCTGGGGTTGGACTTCT Chr9:108651015..108651034 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTCATTAATCGCCTTGCAG Chr9:108633656..108633677 59.7 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000032601